ID: 1167114651

View in Genome Browser
Species Human (GRCh38)
Location 19:47481799-47481821
Sequence GAACACAGATGGTCTAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167114651_1167114656 5 Left 1167114651 19:47481799-47481821 CCTGTTCTAGACCATCTGTGTTC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1167114656 19:47481827-47481849 TGGAATCTGGAACTCTAGAATGG 0: 1
1: 0
2: 0
3: 23
4: 183
1167114651_1167114657 21 Left 1167114651 19:47481799-47481821 CCTGTTCTAGACCATCTGTGTTC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1167114657 19:47481843-47481865 AGAATGGAACCCACACACTTTGG 0: 1
1: 0
2: 3
3: 13
4: 185
1167114651_1167114659 23 Left 1167114651 19:47481799-47481821 CCTGTTCTAGACCATCTGTGTTC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1167114659 19:47481845-47481867 AATGGAACCCACACACTTTGGGG 0: 1
1: 0
2: 2
3: 17
4: 242
1167114651_1167114658 22 Left 1167114651 19:47481799-47481821 CCTGTTCTAGACCATCTGTGTTC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1167114658 19:47481844-47481866 GAATGGAACCCACACACTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 222
1167114651_1167114655 -8 Left 1167114651 19:47481799-47481821 CCTGTTCTAGACCATCTGTGTTC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1167114655 19:47481814-47481836 CTGTGTTCTGGAATGGAATCTGG 0: 1
1: 0
2: 3
3: 19
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167114651 Original CRISPR GAACACAGATGGTCTAGAAC AGG (reversed) Intronic
902397199 1:16138875-16138897 AAACACACATGGTCAAGAAGAGG - Intronic
906670659 1:47651957-47651979 GAAGAAAGATGGTTAAGAACTGG - Intergenic
915626715 1:157118422-157118444 GAACAGAGAGGCTCTAGAACTGG - Intergenic
917849145 1:179045523-179045545 GATCACTGTTGGTCTGGAACTGG + Intronic
918015047 1:180624981-180625003 GAATACACATGGGTTAGAACAGG - Intergenic
918486748 1:185036769-185036791 GAAAACAGCTGTTCTAGATCAGG - Intergenic
921998373 1:221446995-221447017 GAACACAGACGAGCTAGGACAGG + Intergenic
922928456 1:229370552-229370574 AAGCCCAGATGATCTAGAACTGG - Intergenic
924421387 1:243913356-243913378 GAACAGGGATGGACTAGAATAGG - Intergenic
1063818388 10:9805246-9805268 GAAATCAGAAGGTCAAGAACTGG + Intergenic
1064304637 10:14154062-14154084 AAACACAGATGGTTTAAGACAGG - Intronic
1067753863 10:48989379-48989401 GAAAGCAGATGGCCTAGAAGAGG + Intergenic
1070353376 10:75614868-75614890 GAACACAGATGTTCCACAATGGG - Intronic
1073703281 10:105954481-105954503 GAAGTCAGATGGGCTGGAACAGG + Intergenic
1073874301 10:107903541-107903563 TAAGACTGATGGTCTAGTACAGG - Intergenic
1073946172 10:108753167-108753189 TAAGACAGCTGGTCTGGAACAGG + Intergenic
1074674578 10:115833911-115833933 GAACACATATGGTGAAGAGCAGG - Intronic
1075002323 10:118807984-118808006 GAACACACATTGTCTAGCAGAGG - Intergenic
1076132937 10:128026247-128026269 GAACACAGATGGATGAGGACAGG - Intronic
1078417095 11:11174743-11174765 GAAAACAGATGCTCTTGAAAAGG - Intergenic
1080693454 11:34579862-34579884 GGACACAGTTGGTCTAACACAGG - Intergenic
1082707123 11:56506068-56506090 GAAGACAGATGGTGGAGTACTGG - Intergenic
1083760989 11:64817653-64817675 GAACTAAAATGATCTAGAACTGG + Intergenic
1088125607 11:106419793-106419815 TAACACAGATGCTCTACACCAGG + Intergenic
1088721845 11:112599395-112599417 TAAAGCAGATGCTCTAGAACAGG - Intergenic
1090517224 11:127441881-127441903 CAACACAGAGGCTCAAGAACTGG + Intergenic
1091142146 11:133244461-133244483 GAACACACGGGGTATAGAACAGG + Intronic
1092512379 12:9170668-9170690 GAATACAGATGGTCTGGATGAGG + Intronic
1096243920 12:49973997-49974019 GAACACAGATGGTTACGAAATGG - Intronic
1097406486 12:59196344-59196366 GAACATAGATGGAGTACAACTGG + Intergenic
1098174550 12:67777411-67777433 GAACACAGATGTACAGGAACTGG - Intergenic
1104719900 12:131039408-131039430 GACCGAAGATGGTCTAGACCGGG - Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108522297 13:51257470-51257492 GCACACAAATGGTCTAGATCTGG - Intronic
1113901232 13:113799302-113799324 AAACACAGATGGAATAAAACAGG - Intronic
1114392111 14:22320834-22320856 GAAGAGAGATGGTCTAGAAGGGG - Intergenic
1118822015 14:69352001-69352023 GAACAGAGATGGGTTAGAAGAGG - Intronic
1120283084 14:82463804-82463826 GAACACAGGTGGTCTGGACAAGG + Intergenic
1121933875 14:97998489-97998511 AAACACTGATGGAATAGAACTGG - Intergenic
1126803314 15:52320318-52320340 AAACACAGATTCCCTAGAACCGG + Intronic
1131580845 15:93641513-93641535 GATCACAGATAGTATATAACAGG + Intergenic
1135874118 16:26181504-26181526 GAAGACAGAAAGTCTAGAAAAGG - Intergenic
1137337587 16:47565650-47565672 GAACAGGGATGGTCGAGGACAGG - Intronic
1137741433 16:50779921-50779943 GAACTCACATGGTCTAGAAGTGG + Exonic
1138615420 16:58161686-58161708 GAAAAGAGATGGTCTGAAACTGG + Intronic
1142493729 17:294973-294995 GGACACAGATGCTGTAGAAATGG + Intronic
1143163055 17:4883997-4884019 GAATACAGATGGAAAAGAACTGG - Intronic
1143916712 17:10299044-10299066 GAAGACAGATGCTTTAGAAAAGG - Intronic
1144395276 17:14837253-14837275 GAAGACAACTGGTTTAGAACAGG - Intergenic
1145056480 17:19706906-19706928 GAATGCAGCTGGTCTAGAGCTGG + Intronic
1146537571 17:33666412-33666434 AAGCACAGATATTCTAGAACTGG + Intronic
1147858042 17:43498048-43498070 GAGCACAAATGCTCTAGAAATGG + Intronic
1148033962 17:44643856-44643878 GAAAGCTGATGGTCTAGAACGGG + Intergenic
1149419383 17:56494338-56494360 GAACACAGATGGTGGGGAAGGGG + Intronic
1152210834 17:79002252-79002274 GAGCCCAGATGGTCTATATCAGG - Intronic
1153411860 18:4802651-4802673 GCACACAGATGGTCATGTACAGG + Intergenic
1156794530 18:41027097-41027119 CAACACAAATGGACTAAAACAGG + Intergenic
1161427107 19:4209757-4209779 GAACAGAGATGCTTTAAAACTGG - Intronic
1164435896 19:28228979-28229001 GAACACAGACTGTCAAGGACAGG + Intergenic
1165296775 19:34933634-34933656 GATCACATGTGGTTTAGAACGGG - Exonic
1167114651 19:47481799-47481821 GAACACAGATGGTCTAGAACAGG - Intronic
925442264 2:3899010-3899032 GAATACAGATGGTCTGGAAGAGG - Intergenic
927107230 2:19838471-19838493 GTACACAGTTGGTATAGAAAAGG + Intergenic
929459002 2:42087590-42087612 GAACACAGCTGCTCTATAAATGG + Intergenic
930135409 2:47898737-47898759 TAGGACAGATGGTATAGAACAGG + Intronic
935264801 2:101385096-101385118 TAACACAGATGGACTAAGACAGG + Intronic
935356789 2:102208753-102208775 GAACATAGGAGGACTAGAACGGG - Intronic
937896181 2:126978172-126978194 ACACACAGATGGTCTAGCACAGG + Intergenic
939399005 2:141667615-141667637 GAACATATATGGTCTAAAGCTGG - Intronic
940129159 2:150361882-150361904 TAACATAGAGGGTCTAGAATAGG + Intergenic
941171575 2:162144222-162144244 GATCACAGATTGTCTACCACTGG + Intronic
941710969 2:168712894-168712916 GTACACAGAGGGGCTAGACCAGG - Intronic
944282201 2:197910900-197910922 GAATAAAGATGATCTAGAAGTGG + Intronic
947464147 2:230326367-230326389 GAACCCAGATGATCTAGACATGG - Intergenic
947473051 2:230415402-230415424 GAACCCAGATGATCTAGACATGG - Intergenic
948158094 2:235800864-235800886 GAAGTCAGATGGTTTAAAACAGG - Intronic
948855619 2:240729231-240729253 GAAGACAGAGGGTCCAGCACAGG - Intronic
1172136164 20:32688398-32688420 GAACAGAGATGGTAAGGAACTGG + Intergenic
1174192077 20:48747765-48747787 CAACACAGATGCTCTAGAACAGG + Intronic
1175026335 20:55906429-55906451 CATCACAGATGGTTTATAACAGG - Intergenic
1176056663 20:63152556-63152578 GCACAGAGAGGGTCAAGAACTGG + Intergenic
1177063688 21:16402826-16402848 CAACACTGATGGTGTAGAAGTGG - Intergenic
1181385910 22:22545671-22545693 GAACATGGATGGTCCAGCACAGG - Intergenic
1181927868 22:26375001-26375023 GAACTCAAAAGGTCTAGGACGGG + Intronic
1182194924 22:28506231-28506253 GAACACAGACGGTCTGGATGAGG + Intronic
1182695933 22:32199371-32199393 AAACACAGAGGGTCTCTAACCGG + Intronic
1183377994 22:37476230-37476252 GGACACAGGTGTTCTAGAAGTGG - Intronic
949408398 3:3738549-3738571 GAACAAAGATGGACTGGACCAGG + Intronic
951433281 3:22632960-22632982 CAACACAGTTGCTCTAGAAGAGG - Intergenic
952092443 3:29905269-29905291 GAATACAGATGCTCTAAAGCTGG - Intronic
958817120 3:98928432-98928454 GAATACAGATGGTCTGGATGAGG + Intergenic
960058494 3:113294552-113294574 GGACGCAGATGGTCTGGAAGTGG + Intronic
961883146 3:130077303-130077325 AAACACTGATTGTCTAAAACGGG + Intergenic
962998765 3:140656505-140656527 GAACCCAAATGGTCTAGACAAGG + Intergenic
964433942 3:156632975-156632997 CAACACAAATGGACTAAAACAGG + Intergenic
964738074 3:159936549-159936571 GAACTCAGATGGTGAACAACTGG - Intergenic
967149674 3:186637143-186637165 GAACACAGAGTGTTTAGCACAGG + Intronic
971343925 4:25795439-25795461 GAAAACAGAAGGACTAGAACTGG + Intronic
973972475 4:56227108-56227130 CAACACAAATGGACTAAAACAGG + Intronic
978425928 4:108582361-108582383 TATCACAGATGATCAAGAACTGG - Intergenic
978693586 4:111547020-111547042 GAACCCAGATGATCTAGATAGGG - Intergenic
980185381 4:129454783-129454805 TAAAACAGATAGTCTGGAACTGG + Intergenic
990724577 5:58739678-58739700 GAAAATTGATGGTCTAGAAAGGG - Intronic
994268991 5:97754145-97754167 GAACACAGATGGTTAAGTACTGG + Intergenic
998259989 5:140623052-140623074 TAACACAGATGTTCTGGAACAGG + Intergenic
998404345 5:141865455-141865477 GAACAGAGATGGTTTAGATCAGG + Intronic
999813985 5:155157340-155157362 GAACACTGATTGTCTATAAGAGG + Intergenic
1002050349 5:176567085-176567107 GAGCAGAGATTGACTAGAACTGG - Intronic
1002199556 5:177520069-177520091 GAGCACAGAGGGTCTTGGACGGG + Exonic
1004375326 6:15086097-15086119 GAACACAGAGAGTGTAGAACTGG - Intergenic
1009752479 6:67889757-67889779 GAACAGATGTAGTCTAGAACTGG - Intergenic
1011056631 6:83211409-83211431 GAACATATATGATCTAGGACTGG + Exonic
1012140602 6:95622606-95622628 AAGCACACATGCTCTAGAACTGG - Intergenic
1012508848 6:99979205-99979227 GAACACAGAGGGTCTCTAATTGG + Intronic
1013589646 6:111609341-111609363 GAAAACAGTTGGTGGAGAACTGG - Intergenic
1013697158 6:112716908-112716930 TAAAAAAGATGGTCTAGGACTGG - Intergenic
1013953700 6:115816488-115816510 GAACACTGATGTCCTGGAACAGG + Intergenic
1015397008 6:132745945-132745967 GAAAACAGATGCTTTACAACTGG + Intronic
1021098613 7:16562410-16562432 GAAAACTGAAGGTTTAGAACAGG - Intronic
1021958330 7:25848922-25848944 GCACCCAGATGATCTGGAACTGG + Intergenic
1022284098 7:28938660-28938682 GAACAGAGATGGTCCAGACATGG - Intergenic
1023954825 7:44876132-44876154 CAACCCAGAAGTTCTAGAACAGG + Intergenic
1024019936 7:45359604-45359626 GAAGGAAGAGGGTCTAGAACAGG + Intergenic
1026099794 7:67375339-67375361 GAACACAGCTGTTCAAGACCAGG + Intergenic
1027537655 7:79425418-79425440 GCACACAGGTGGTCCAGGACTGG - Intronic
1029876756 7:103762288-103762310 GAAGATAGATGGTCTAGGGCTGG - Intronic
1036810359 8:11864043-11864065 TAACACAAATGGACTAGAACTGG + Intronic
1037047096 8:14320565-14320587 GAACACACAAGGTGCAGAACTGG + Intronic
1040353324 8:46590113-46590135 GAAAACTGATGATCTAGAAATGG + Intergenic
1041249945 8:55924305-55924327 GAAAACAGATGGTATAGAACAGG - Intronic
1042419484 8:68569030-68569052 GAAAACAGACAGTCTACAACGGG - Intronic
1043393844 8:79817597-79817619 GTACACTGAGGGTCTGGAACAGG + Intergenic
1044024839 8:87155992-87156014 GAAAACAGACGGACTAGAAATGG + Intronic
1044084390 8:87926224-87926246 GCACAGAGGTGGTCAAGAACAGG + Intergenic
1046352260 8:113031238-113031260 GAACACAAATGGTCTACAACAGG + Intronic
1046735092 8:117768334-117768356 GAAAAGAGATGATCTAAAACTGG + Intergenic
1047864440 8:129006418-129006440 GGACACAGGTGGTCAAGAAGCGG - Intergenic
1050621366 9:7455561-7455583 GATCCCAGATAGTCTAGACCAGG + Intergenic
1051519526 9:17970146-17970168 AAATACTGATGGTCTAGAATGGG - Intergenic
1051567948 9:18521954-18521976 GAACACCCAGGGACTAGAACTGG - Intronic
1052515326 9:29472584-29472606 TAACACAGATGGTCTGGATGAGG - Intergenic
1052721663 9:32178777-32178799 GAAAACAGATGATCCATAACAGG + Intergenic
1052833584 9:33234328-33234350 GGACACAGATGACCTAAAACAGG - Intronic
1055050975 9:71980453-71980475 TAGAAAAGATGGTCTAGAACAGG + Intronic
1186399394 X:9242717-9242739 GTGCACAGATGGTCTACAGCAGG - Intergenic
1186645795 X:11506054-11506076 GAACACAGAAGAGCTTGAACGGG + Intronic
1186765668 X:12768263-12768285 AAACACCGATGGTTTAAAACAGG - Intergenic
1186804148 X:13122814-13122836 GAACAGTGAGGGTCTATAACTGG + Intergenic
1187742537 X:22372151-22372173 GAACACGGATGGGGTATAACTGG + Intergenic
1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG + Intergenic
1188231645 X:27670999-27671021 CAACACAAATGGACTAAAACAGG + Intronic
1188894814 X:35654009-35654031 GATAACTGATGATCTAGAACAGG + Intergenic
1190422050 X:50294943-50294965 GAACACACATGCTCTTGGACTGG + Exonic
1191099657 X:56711960-56711982 GAATACAGATGGTCTAGAAAAGG - Intergenic
1194014254 X:88599611-88599633 GAAAATAGATGGTCTAAAATTGG - Intergenic
1194281380 X:91958088-91958110 GAATACAGATGGTCCAGATAAGG - Intronic
1194910156 X:99631436-99631458 GAACAGAGATGATCTGAAACTGG - Intergenic
1196135292 X:112202371-112202393 TAACACAGATGGTCTTGTGCAGG - Intergenic
1200598969 Y:5182744-5182766 GAATACAGATGGTCCAGATAAGG - Intronic