ID: 1167116637

View in Genome Browser
Species Human (GRCh38)
Location 19:47492585-47492607
Sequence CACTGTGGATGAGGACCATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167116624_1167116637 19 Left 1167116624 19:47492543-47492565 CCGTGCACGCTGGGGGGACCCCA 0: 1
1: 0
2: 1
3: 13
4: 107
Right 1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG 0: 1
1: 0
2: 0
3: 15
4: 127
1167116627_1167116637 -1 Left 1167116627 19:47492563-47492585 CCATGTGACACTCCCTCCCTCCC 0: 1
1: 0
2: 9
3: 146
4: 1701
Right 1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG 0: 1
1: 0
2: 0
3: 15
4: 127
1167116625_1167116637 1 Left 1167116625 19:47492561-47492583 CCCCATGTGACACTCCCTCCCTC 0: 1
1: 0
2: 5
3: 42
4: 451
Right 1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG 0: 1
1: 0
2: 0
3: 15
4: 127
1167116618_1167116637 28 Left 1167116618 19:47492534-47492556 CCCAGGGCTCCGTGCACGCTGGG 0: 1
1: 0
2: 1
3: 20
4: 153
Right 1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG 0: 1
1: 0
2: 0
3: 15
4: 127
1167116626_1167116637 0 Left 1167116626 19:47492562-47492584 CCCATGTGACACTCCCTCCCTCC 0: 1
1: 0
2: 3
3: 32
4: 386
Right 1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG 0: 1
1: 0
2: 0
3: 15
4: 127
1167116620_1167116637 27 Left 1167116620 19:47492535-47492557 CCAGGGCTCCGTGCACGCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 199
Right 1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG 0: 1
1: 0
2: 0
3: 15
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167116637 Original CRISPR CACTGTGGATGAGGACCATC GGG Intronic
901477167 1:9497725-9497747 CAGTGGGGATGTGGACCAACAGG - Intergenic
901490331 1:9593380-9593402 CACTGTGGGAGAGGACCCCCTGG + Intronic
902042685 1:13504241-13504263 CACTGAGGACCAGGAACATCAGG + Intronic
902398110 1:16143370-16143392 CACTGTGGAGAAGGTCCACCAGG + Intronic
904092434 1:27954709-27954731 CACTGCAGATGAGGACCCTGAGG + Intronic
904295464 1:29517315-29517337 CACTGGGGAAGAGAAGCATCAGG - Intergenic
905166485 1:36086114-36086136 TATTGTGGATGAGGAGCAACTGG + Intronic
906231794 1:44170758-44170780 CAATGGGGTTCAGGACCATCTGG + Intergenic
913227303 1:116711434-116711456 CACTGTGGATGGGCACTGTCTGG + Intergenic
921753420 1:218824364-218824386 AATTGTGGATGTTGACCATCAGG + Intergenic
922193812 1:223342093-223342115 CACTGTGGCTGTGGTCCACCAGG - Intronic
923510758 1:234650460-234650482 CAATGAGGATGAGGACCTTTAGG - Intergenic
1063314720 10:4991495-4991517 CACTGTGGATATGGCCCATGTGG - Intronic
1064185461 10:13158392-13158414 AACTGTGGATGAGGAACCTACGG - Intergenic
1070774917 10:79103801-79103823 CATCATGGATGAGGACCTTCCGG + Intronic
1070788669 10:79176980-79177002 CACTGGGAATGAGGCCCCTCAGG + Intronic
1071256342 10:83875288-83875310 CAGTGTGGATAGGGCCCATCAGG - Intergenic
1076485356 10:130812072-130812094 CTCACTGGATGAGGACCCTCAGG - Intergenic
1077006854 11:362428-362450 ACCTGTGGGTGAAGACCATCGGG + Intergenic
1077791107 11:5441190-5441212 AAGTGTGGATGAAGAACATCTGG + Exonic
1078095638 11:8295004-8295026 CACTGTGGATGGGGCCCAGCAGG - Intergenic
1082632052 11:55555053-55555075 CACTGTTGATGACCACCATGAGG - Exonic
1082767558 11:57181355-57181377 CACTGAGGCTGAGGACTCTCAGG + Intergenic
1084353146 11:68618159-68618181 CTGTGTGGAAGAGGACGATCCGG - Intergenic
1085732938 11:79014590-79014612 CTCTGTGCATGAAGACCATTTGG - Intronic
1087066865 11:94035697-94035719 CACTCTGGAGGGGGACCAACAGG - Intronic
1088835651 11:113576147-113576169 CCCTGTTGCTGAGGAGCATCTGG - Intergenic
1089319533 11:117615603-117615625 CACTGGGAATGAGGAACAGCTGG - Intronic
1096762356 12:53852612-53852634 CACTGTGGATCTGAATCATCTGG + Intergenic
1097682172 12:62659039-62659061 CGCTGTGGATCAGGAACTTCCGG - Intronic
1098787725 12:74780994-74781016 CAATGTGGGTGGGCACCATCTGG + Intergenic
1099104831 12:78485070-78485092 CACTGTAGATAAGGACCGGCGGG - Intergenic
1104463064 12:128970516-128970538 CACTGCAGCTGAGGACCCTCTGG + Intronic
1104644024 12:130484479-130484501 CACTGGGGATGAGGATGCTCAGG - Intronic
1107037438 13:35916340-35916362 CAAAGTGGATTAGCACCATCTGG + Intronic
1107890733 13:44911996-44912018 CCCCCTGGATGAGGACCTTCTGG - Intergenic
1108078802 13:46710970-46710992 CACTGTCTCTGTGGACCATCTGG + Intronic
1109036131 13:57262888-57262910 CAATGTGGAACAGGACTATCTGG + Intergenic
1110380541 13:74845079-74845101 CAATGTGAATGAGCACCATCCGG - Intergenic
1110679537 13:78292546-78292568 CACTGGTGATGAGGAAAATCTGG + Intergenic
1111796254 13:92924198-92924220 CAATGGGGAGGAGGAGCATCAGG - Intergenic
1112288456 13:98124480-98124502 CAGTGTGGTTGAGGAACAGCTGG - Intergenic
1113108428 13:106796378-106796400 CACTGTAGAGGAAGAACATCTGG + Intergenic
1113188517 13:107717431-107717453 CAGTGTGCATCAGGATCATCTGG - Intronic
1113928730 13:113955080-113955102 CAGTGGGGATGAGGAGCAGCTGG + Intergenic
1117095159 14:52289998-52290020 CATTCAGGATGAGTACCATCAGG + Intergenic
1117610623 14:57479521-57479543 CAGTGTGCATGAGAATCATCTGG + Intronic
1121728308 14:96168870-96168892 CAGTGGGGATGAAGACCATGTGG - Intergenic
1122325981 14:100880885-100880907 CACTGTGGATGTGGAGCAGGCGG + Exonic
1122942693 14:104989469-104989491 CTCTGTGGCTGAGAACCATGAGG - Intronic
1126978907 15:54218781-54218803 CACTATTGATGAGGAGCTTCAGG + Intronic
1128768594 15:70265823-70265845 CACTGAGGACGATGACCATCTGG + Intergenic
1133686398 16:8169316-8169338 CACTGTGGACAAGCACCACCGGG - Intergenic
1135693687 16:24567279-24567301 AACTGTGGAGGAGGAACACCCGG - Exonic
1137664860 16:50244238-50244260 CAGTGGCGATGAGGACCATGGGG + Intergenic
1140590149 16:76342141-76342163 AACTGTGTATGAAGATCATCTGG + Intronic
1142845691 17:2674014-2674036 CACTGTGAATGACAATCATCAGG - Intronic
1142900017 17:3005886-3005908 CACTGTGGCTGAAGACCTTCTGG + Intronic
1143125507 17:4639106-4639128 CACTGTGGGCGAGGACCCTCAGG - Exonic
1148704986 17:49622205-49622227 AAATGTGGATGAGGAACATAAGG - Intronic
1149168130 17:53778762-53778784 CACTGTGGATGATGAGAATAGGG + Intergenic
1149566649 17:57645124-57645146 CACTGTGCATCAGAATCATCCGG + Intronic
1151354392 17:73549955-73549977 GACTGTGGGTGAGGACCGCCGGG + Intronic
1152033681 17:77858777-77858799 CACTGGGGGTGAGTGCCATCAGG - Intergenic
1152813726 17:82394725-82394747 CACTGTCAGTGTGGACCATCTGG - Intronic
1153413095 18:4815985-4816007 CAGTGTGGAAGAGGACCAGAGGG - Intergenic
1153449399 18:5209949-5209971 CAGTGTGGATGGGCATCATCCGG - Intergenic
1158578233 18:58658362-58658384 CAGTGTGGATCAGGATCACCTGG + Intergenic
1161220320 19:3115426-3115448 CACTGAGGATGAAGACCAATGGG - Intronic
1163018156 19:14469470-14469492 CGCTGTGGATGTGCAGCATCAGG - Exonic
1165762082 19:38327298-38327320 CAATGCGGATGAGGACGATCGGG + Exonic
1167116637 19:47492585-47492607 CACTGTGGATGAGGACCATCGGG + Intronic
1168168406 19:54570971-54570993 CACTGTTAATAAGAACCATCAGG + Intergenic
929910113 2:46082618-46082640 CAGTGAGGATGGGGAGCATCTGG + Intronic
930398756 2:50856248-50856270 AACTATGGATGAGGACCTTCAGG + Intronic
934860379 2:97759533-97759555 CACTGTGGAAGAGGCCCCGCAGG - Intronic
942394706 2:175535119-175535141 CACTGGGGATGAGTACCACCTGG - Intergenic
943449338 2:188028594-188028616 CAGAGTGGGTAAGGACCATCAGG + Intergenic
945906253 2:215596755-215596777 CACTGTGGAGAAGGACTCTCTGG - Intergenic
946618066 2:221530838-221530860 CACAGTGGAGGAGTACGATCTGG - Intronic
946823833 2:223656378-223656400 CACTGTGGAATAAAACCATCTGG + Intergenic
1172219886 20:33266486-33266508 CGCTGAGGATGAGGACAATTTGG + Intergenic
1173196231 20:40915102-40915124 CACTGAGGATGTGGCCCATCAGG - Intergenic
1174305741 20:49613168-49613190 CACTAAGCATGAGGACCGTCAGG + Intergenic
1174694401 20:52542736-52542758 CACTTTGGCTGAGAACCACCAGG + Intergenic
1176059596 20:63166680-63166702 AACTTTGGATGAGGAACAGCAGG + Intergenic
1176088486 20:63308699-63308721 CGCTGTGGGTGAGCACCATGCGG + Exonic
1182419892 22:30243872-30243894 CACTGGGGTTGAGGATCTTCTGG + Exonic
1183328055 22:37205034-37205056 GACTGTGGAGGGGGACCATGGGG - Exonic
1183954184 22:41369266-41369288 CACTGTGGATGAGCAAAGTCAGG + Intronic
1184091376 22:42294727-42294749 CTCTGTAGATGAGGACAATGAGG + Intronic
1185373910 22:50473430-50473452 CAGTGGGGATGAGGACTATGTGG + Intronic
954432132 3:50476384-50476406 CACAGTGCATGAGGAGCACCTGG - Intronic
960829930 3:121835388-121835410 CGCTGTGAGTGAGGACCATCCGG + Exonic
963264599 3:143228236-143228258 GCCTGTGGAGGAGGACCCTCAGG - Intergenic
963264633 3:143228388-143228410 GCCTGTGGAGGAGGACCCTCAGG + Intergenic
965858002 3:173112333-173112355 CAATGTGCACAAGGACCATCTGG + Intronic
985679640 5:1249218-1249240 CCCTGAGGATGAGCCCCATCAGG - Intergenic
986726873 5:10605038-10605060 CACTTTGGAAGAGGACCCTGTGG - Intronic
987066816 5:14297854-14297876 CACTGTGGCTGAGGAGGAGCTGG - Intronic
987086333 5:14472359-14472381 CACAGTGCATGAGGGCAATCAGG - Intronic
989132177 5:38118347-38118369 CACTATGAATGAGAAACATCTGG - Intergenic
990557936 5:56953227-56953249 CAGTGTGGATGTGGACCTTCCGG - Intronic
997630958 5:135368758-135368780 CAGTGTGGAGGAGCACCCTCCGG - Intronic
999434948 5:151556246-151556268 CACTGTGGCTGAGGAGGGTCTGG - Intronic
1001685255 5:173589897-173589919 CACTGTTGATGCTGACCACCTGG + Intergenic
1004744448 6:18496019-18496041 CACTGAGGAAGTGGACCCTCTGG - Intergenic
1009564220 6:65291319-65291341 CAGTGTGCAGGAGGACCATTTGG - Intronic
1017246914 6:152236918-152236940 CCATCTGGATGAGGACCAGCAGG - Exonic
1019540887 7:1550524-1550546 CGCTGGGGATGGGGTCCATCAGG - Intronic
1021148499 7:17119833-17119855 CACTGTGGATGAGAGTGATCTGG + Intergenic
1023891050 7:44392365-44392387 CACCGTGGATGAGGAGGAACAGG - Exonic
1024410645 7:49037473-49037495 CACTGGGGAAGAGGATCTTCTGG - Intergenic
1025627475 7:63234177-63234199 CTCCATGAATGAGGACCATCCGG - Intergenic
1026874444 7:73871348-73871370 CACTGTGGAGGAGAATTATCAGG - Intergenic
1029302380 7:99591840-99591862 CACCGTGGATGTGCACCATGTGG - Intronic
1029985307 7:104917445-104917467 GACTGTGGATGAAGACCAACTGG + Intergenic
1032508807 7:132455769-132455791 CAGACTGGCTGAGGACCATCTGG - Intronic
1032771088 7:135057544-135057566 CAGTGAGGATGAGGAGCAACAGG + Intronic
1033675185 7:143534009-143534031 TACTGTGGAAGAGGAGCATTTGG + Intergenic
1033696651 7:143795432-143795454 TACTGTGGAAGAGGAGCATTTGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038269174 8:26061418-26061440 CACTGGGAATGAAGACCATGGGG + Intergenic
1039478156 8:37852270-37852292 CACTGAGGAAGAGGAGGATCTGG + Intergenic
1041087493 8:54270353-54270375 CACTGTGCATGATGACACTCTGG + Intergenic
1042170368 8:65985380-65985402 CAGTGTGGATGAGAACGATGGGG + Intergenic
1053178689 9:35949048-35949070 CAGGGAGGTTGAGGACCATCAGG + Intergenic
1056578684 9:87874477-87874499 CAGTCTGGATAACGACCATCTGG + Intergenic
1056955734 9:91079653-91079675 CAGTGTGCATGAGAACCACCTGG + Intergenic
1059298939 9:113297668-113297690 CACTGAGGATGACGGCCATCAGG + Exonic
1186979130 X:14939954-14939976 CACTGTGGCTGAGAACCACTGGG + Intergenic
1190957876 X:55213927-55213949 CACTGTGAATGAGGAGCCTCTGG + Intronic
1194644846 X:96447303-96447325 CACTGTGGATGTGAATCAGCTGG - Intergenic
1194984111 X:100471581-100471603 AACTGTGGAAGAGAGCCATCTGG + Intergenic
1198476749 X:137001784-137001806 CACTGTGGCCAAGGACCATCAGG - Intergenic
1198774146 X:140161821-140161843 CTCTGGGGATGAGGCCCAGCAGG + Intergenic
1199622792 X:149714529-149714551 CACTGTAGTTGTGGACCATATGG - Exonic
1199628487 X:149760827-149760849 CACTGTAGTTGTGGACCATACGG - Intergenic
1199879554 X:151962448-151962470 CCTTGTAGATGCGGACCATCTGG + Exonic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic