ID: 1167121701

View in Genome Browser
Species Human (GRCh38)
Location 19:47521154-47521176
Sequence AACGCCCTGGAGAGGCCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167121685_1167121701 22 Left 1167121685 19:47521109-47521131 CCAACAGGGGACAGGGAGGGTGG 0: 1
1: 0
2: 1
3: 42
4: 461
Right 1167121701 19:47521154-47521176 AACGCCCTGGAGAGGCCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167121701 Original CRISPR AACGCCCTGGAGAGGCCGAA GGG Exonic