ID: 1167126041

View in Genome Browser
Species Human (GRCh38)
Location 19:47549370-47549392
Sequence GTCCAGAAGTGGGTTTTGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167126036_1167126041 -9 Left 1167126036 19:47549356-47549378 CCGCACAGGCTGCAGTCCAGAAG 0: 1
1: 0
2: 1
3: 60
4: 730
Right 1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1167126035_1167126041 -8 Left 1167126035 19:47549355-47549377 CCCGCACAGGCTGCAGTCCAGAA 0: 1
1: 0
2: 0
3: 31
4: 1086
Right 1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1167126034_1167126041 -4 Left 1167126034 19:47549351-47549373 CCTTCCCGCACAGGCTGCAGTCC 0: 1
1: 0
2: 2
3: 19
4: 347
Right 1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167126041 Original CRISPR GTCCAGAAGTGGGTTTTGAG GGG Exonic
902390524 1:16101938-16101960 GTCCAGAAGTAGGTTCTGTGAGG - Intergenic
903818786 1:26084992-26085014 ATGCAGAAGAGGGTCTTGAGGGG - Intergenic
906297562 1:44658488-44658510 AGCCAGAAGTGAGTTTAGAGGGG - Intronic
907733210 1:57087506-57087528 TTCTAGACGTGGGTGTTGAGAGG + Intronic
908200353 1:61788969-61788991 GACCAGAAATAGGTTTTGAAGGG + Intronic
909484154 1:76155156-76155178 GTCTAGAAGTGGTTGTTGGGTGG + Intronic
910944590 1:92576633-92576655 GTACAGAAGTGGCTTTTGAATGG + Intronic
911164826 1:94715248-94715270 GCCCAGAAGTGGATCCTGAGAGG + Intergenic
911966902 1:104382245-104382267 GTCCTGTTGTGGGGTTTGAGGGG - Intergenic
917844082 1:179006029-179006051 AGGCAGAAGTGGGTTTTGCGGGG + Intergenic
920527739 1:206680276-206680298 TTCCAAGAGTGGGTTTTTAGTGG + Intronic
921010217 1:211133889-211133911 CTCCAGAAACGTGTTTTGAGGGG + Exonic
923052522 1:230398742-230398764 TCCCAGAACTGGGTTTTTAGGGG + Intronic
924012904 1:239685521-239685543 GTCCAGAACACAGTTTTGAGAGG - Intronic
1062785857 10:264116-264138 GGCCACAAGTGGGTTTTTAAAGG + Intergenic
1062907607 10:1189367-1189389 GTGGAGAAGTGGGTTTCGAAAGG + Intronic
1063863777 10:10341896-10341918 CTGCAGAAGTAGGTTTAGAGGGG + Intergenic
1065934165 10:30505807-30505829 GTTAAGAGCTGGGTTTTGAGTGG + Intergenic
1068005088 10:51383624-51383646 GTCAAGAGATGGGTTTAGAGTGG - Intronic
1068312751 10:55298977-55298999 GTCCAAAAGAGATTTTTGAGAGG - Intronic
1068455726 10:57251257-57251279 GTCCAAAAGGGGGTTGTGTGTGG + Intergenic
1071240254 10:83697286-83697308 AACCAGAAGTGGGATTTGAAGGG - Intergenic
1072794666 10:98345425-98345447 GTCATTAAGTGGTTTTTGAGGGG + Intergenic
1072806497 10:98427013-98427035 GTCCAGGAATGGGCTGTGAGGGG - Intronic
1073063671 10:100746192-100746214 GTCCTGAAGTTGAGTTTGAGAGG + Exonic
1074981220 10:118621360-118621382 GTCCAGAAGTGGGTGTGGGCTGG - Intergenic
1075169717 10:120102032-120102054 GTCCATAAGTGGGAGTTGGGAGG + Intergenic
1075528448 10:123205322-123205344 GTTCAGAAGTGGGGTCTGGGTGG + Intergenic
1082275298 11:50214770-50214792 GCCCAGAAGTGTTTTTAGAGAGG - Intergenic
1084955728 11:72690365-72690387 CTGCAGAAGTGGGTCTTGGGAGG + Intronic
1085401843 11:76240186-76240208 GTCCAGAGGGAGGTTGTGAGCGG + Intergenic
1086390790 11:86360688-86360710 GGCCAGAACTGTGTTTTCAGTGG + Intergenic
1086766938 11:90707122-90707144 GTCCTGAAGTGGTATTTGGGTGG + Intergenic
1087801674 11:102511113-102511135 GAATAAAAGTGGGTTTTGAGAGG + Intergenic
1087843585 11:102945579-102945601 GTACAGAAAAGAGTTTTGAGGGG + Intronic
1089650236 11:119908254-119908276 GTCCAGAAATGGGAATGGAGAGG + Intergenic
1089708946 11:120301352-120301374 ATCCAGAACTGGGAGTTGAGAGG - Intronic
1092246503 12:6867205-6867227 GGCCAGAAGTGGTTTTCAAGCGG - Exonic
1093126191 12:15331077-15331099 GGCCGGAAGGGGGTCTTGAGAGG + Intronic
1095050002 12:37546653-37546675 ATCCAGAAATAGGTTTGGAGAGG - Intergenic
1096314048 12:50548146-50548168 ATCTAGAATTGGGTTTAGAGGGG + Intronic
1097191739 12:57222659-57222681 CCCCAGAAGTGGGCTTGGAGAGG - Intronic
1099025557 12:77460233-77460255 GTACAGATGTGGTTTTGGAGTGG - Intergenic
1100993991 12:100282297-100282319 GACTAAAAGTGGGTTTTGTGGGG - Intronic
1103126554 12:118427897-118427919 GTCCAAAGGTGGGTTTTGTTTGG - Intergenic
1103974974 12:124696543-124696565 GGCTGGAAGGGGGTTTTGAGTGG - Intergenic
1104061884 12:125275592-125275614 ATTCTGAAGTGGGTTTTGAAAGG + Intronic
1106038030 13:26063041-26063063 GGCCAAAAGTTGGTCTTGAGAGG + Intergenic
1113428321 13:110228406-110228428 GGCCAGAAGTGGGTAGTGACAGG - Intronic
1114473636 14:22980137-22980159 GTCCAGGAGTGGGGCATGAGTGG + Intronic
1115458083 14:33628644-33628666 GTCAAGAAGTGGCTTGTAAGTGG + Intronic
1116332701 14:43615491-43615513 GGCCCCAAATGGGTTTTGAGGGG - Intergenic
1116585964 14:46704884-46704906 GTTCAAAAATGGCTTTTGAGTGG - Intergenic
1117052966 14:51880596-51880618 GTCTAAAAGTGGATTTTAAGAGG - Intronic
1118696922 14:68394702-68394724 CTCCCCCAGTGGGTTTTGAGGGG + Intronic
1123065297 14:105616077-105616099 GGCCAGACGTGGGTGCTGAGGGG + Intergenic
1123088593 14:105731298-105731320 GGCCAGACGTGGGTGCTGAGGGG + Intergenic
1123094543 14:105760671-105760693 GGCCAGACGTGGATTCTGAGGGG + Intergenic
1125100917 15:35911574-35911596 GTCCAGAAGTGGTTGTGCAGTGG + Intergenic
1125922124 15:43531196-43531218 GTCCAAGAGCGGGTTTGGAGAGG - Exonic
1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG + Intergenic
1126834478 15:52645875-52645897 ATCTAGAATTTGGTTTTGAGAGG - Intronic
1128423921 15:67521011-67521033 GTCAAGGAGCTGGTTTTGAGTGG - Intergenic
1129255762 15:74333151-74333173 CTCCAGAAGGGAGTTTTGAGAGG - Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133467993 16:6046512-6046534 GTCTAAAAGTAGGATTTGAGGGG + Intronic
1136989764 16:35144937-35144959 GACCAGAAATAGGTTTGGAGAGG - Intergenic
1137973059 16:53004830-53004852 CTCTAGAAGGGGGCTTTGAGAGG + Intergenic
1140070998 16:71649480-71649502 GCCCAGAGGTGGGTGTTGGGTGG + Exonic
1140240636 16:73196769-73196791 CACCAGAAGGAGGTTTTGAGAGG + Intergenic
1140951435 16:79822218-79822240 GGGAAGAAGTGGGTTTTGATTGG - Intergenic
1141238707 16:82244497-82244519 GTCAAGAAGAGGGTTCTGTGAGG + Intergenic
1144180440 17:12746595-12746617 TCCCAAAAGTGGGTTTTGAGGGG - Intronic
1145306049 17:21675751-21675773 ATCCAGAAATAGGTTTGGAGAGG + Intergenic
1145370618 17:22303739-22303761 ATCCAGAAATAGGTTTGGAGAGG - Intergenic
1146408937 17:32565418-32565440 GTCCAGAGGTGAGGTTTTAGGGG - Intronic
1147325183 17:39666600-39666622 TCCCAGAAGTGGGCATTGAGGGG - Intergenic
1147746440 17:42697643-42697665 GTTCGGAAGTGGGTCTTGAGGGG - Exonic
1148680040 17:49468388-49468410 GGCCAGAGGTGGGTTTAGAAAGG + Intronic
1148767042 17:50045530-50045552 ATCCAGGGTTGGGTTTTGAGTGG - Intergenic
1158493979 18:57936878-57936900 GTCTAGAAGTGGGATTATAGAGG + Intergenic
1161169426 19:2805553-2805575 GTCCACAGGTGGGTTGTGACTGG + Intronic
1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG + Exonic
1168368124 19:55806979-55807001 GTGCATAAGTGGGTATTTAGGGG - Intronic
1168582340 19:57566039-57566061 ATCCAGAAGTTGCATTTGAGGGG + Intergenic
926022130 2:9505646-9505668 GTCCTTAAGTGGGCTTTGACTGG - Intronic
926963812 2:18387823-18387845 TTCCAGAAGTGAGTCCTGAGAGG + Intergenic
932704005 2:74009539-74009561 ATACAGAAATGGGTTTTCAGGGG + Intronic
932704765 2:74014940-74014962 ATCCAGAAATGGGTTTTCAGTGG - Intronic
933315138 2:80706370-80706392 GTCTTGAAGTGGTTTTTCAGGGG + Intergenic
937060275 2:118975532-118975554 GTCCAGCAGGGGGTTTTCTGAGG + Intronic
939737767 2:145870149-145870171 CTCCAGAAATGGCCTTTGAGTGG - Intergenic
941009887 2:160287376-160287398 GTCCAGAGGTGGAATTGGAGAGG - Intronic
941913946 2:170795643-170795665 GTCCAAAAGTGGTTTTTAAATGG + Intronic
944244164 2:197515041-197515063 TTCCAGAAATGGAATTTGAGAGG - Intronic
949066089 2:241991075-241991097 TTCAACACGTGGGTTTTGAGGGG + Intergenic
1169545520 20:6646488-6646510 GTCCAGAAGTTCATTTTCAGTGG + Intergenic
1169809595 20:9596118-9596140 GACCAGAAGTGGTCATTGAGAGG - Intronic
1171531300 20:25855211-25855233 ATCCAGAAATAGGTTTGGAGAGG + Intronic
1171544523 20:25990167-25990189 ATCCAGAAATAGGTTTGGAGAGG - Intergenic
1172622692 20:36330243-36330265 GGCCAGAGGAGGGTTTTGTGGGG + Intronic
1173367565 20:42400959-42400981 GGCCAGATGTGGGTTTCGGGAGG + Intronic
1174798741 20:53544593-53544615 CTCCAGCAGTGGTTCTTGAGTGG - Intergenic
1175151471 20:56938227-56938249 GTCCATAAGTGAGGTTTGATTGG + Intergenic
1175247735 20:57591763-57591785 TTCTAAAAGTGGGTTTTGATGGG + Intergenic
1175640180 20:60622904-60622926 GCCCAGAATTAGGATTTGAGAGG + Intergenic
1176198964 20:63851368-63851390 GTCCAGACATGGGTTTTGGGTGG - Intergenic
1180013917 21:45070530-45070552 GTCCTGGAGTGGGTTGTGGGGGG + Intergenic
1180961289 22:19763530-19763552 CTCCAGAGGCGGGTTCTGAGAGG - Intronic
1183111153 22:35649521-35649543 CTGCAGAAGTTGGTTTTGTGGGG + Intronic
949268911 3:2191493-2191515 GTACAGAAGGGAGGTTTGAGAGG - Intronic
949526366 3:4908619-4908641 GTACAGAAATAGGTTCTGAGAGG - Intergenic
949541628 3:5036922-5036944 ATCCAGAAGTGGGGGTTGGGTGG + Intergenic
950235457 3:11316125-11316147 GTCCAGGAGTGTGATATGAGGGG - Intronic
954224164 3:49171970-49171992 GTCCAGAAGTGGGGTTGGGGCGG - Intronic
956224006 3:66935757-66935779 GTTCTGAAGTGGGTTTTATGAGG - Intergenic
959418783 3:106108989-106109011 GTCCTGAACTGGGCTGTGAGTGG - Intergenic
962381220 3:134899614-134899636 GTCTAAGAGTGTGTTTTGAGTGG - Intronic
964197873 3:154085397-154085419 GTTTAGAAGTGGGTATTGTGGGG + Intergenic
965214427 3:165843617-165843639 GACCAGAAATGGGTTTTTTGGGG + Intergenic
967301848 3:188021935-188021957 GGCCAAAAGTGTGTTTTGTGTGG - Intergenic
969443018 4:7228344-7228366 TTCAACAGGTGGGTTTTGAGGGG + Intronic
970462504 4:16289289-16289311 GCCCAGAAGTGTTTCTTGAGAGG + Intergenic
974294483 4:59979462-59979484 GGCAAGTAGTGGGTTTTGAAGGG - Intergenic
978572052 4:110148474-110148496 GCCCAGAAGGGGGTTGTGCGGGG + Intronic
979718607 4:123871364-123871386 GTCCTTGAGTGGGTGTTGAGAGG + Intergenic
979892031 4:126110121-126110143 GTAGAGATGTGGGTTTTAAGAGG + Intergenic
981504998 4:145489986-145490008 TTCTAGAAGTAGGTTTGGAGGGG + Intronic
985567162 5:624932-624954 GGCCAGAAGTGGGATTTGGCTGG - Intronic
987236175 5:15944114-15944136 CTCCAGAAGAAGGCTTTGAGAGG - Intergenic
989105554 5:37859947-37859969 GTTCAGCTGTGGGTTTTGACTGG + Intergenic
992204095 5:74413429-74413451 GTGCAGAAGTGGGAGTTAAGTGG - Intergenic
995837537 5:116413460-116413482 GTCCTCAAGTGGCTTGTGAGTGG + Intergenic
996689778 5:126327982-126328004 GTCCAGAAGTGGCTTTCTGGTGG - Intergenic
998103602 5:139454699-139454721 GTCCCCAGGTGGGCTTTGAGAGG - Intronic
999510697 5:152248336-152248358 ATCCAAAAGTGGTTTTTAAGGGG - Intergenic
1000454015 5:161426519-161426541 TTACAGATGTGTGTTTTGAGAGG - Intronic
1001608354 5:172980327-172980349 GGCCAGAAGTGGTTGTTGAAGGG + Intergenic
1002357235 5:178640864-178640886 GTCCTGAAGTGGGATATGGGCGG + Intergenic
1003555186 6:7133040-7133062 GTCGACAAGTGGGTTATGACTGG + Intronic
1006422060 6:33941051-33941073 GTGTAGAAATGGATTTTGAGGGG + Intergenic
1006965457 6:37979498-37979520 GTTTAAAAGTGGGTTTGGAGAGG + Intronic
1007831793 6:44644638-44644660 GCCCAGAAGTTGGTTTGTAGAGG + Intergenic
1007955708 6:45916065-45916087 GACAAAAAGTGGGTTATGAGAGG - Intronic
1010499631 6:76581476-76581498 AGTCAGAAGTGGGTTTTAAGAGG + Intergenic
1011377800 6:86708414-86708436 GTACAGTAGTGGGTTATGAGAGG - Intergenic
1012437167 6:99226716-99226738 GTCCAGAAGTGGGCTTTGGCTGG - Intergenic
1015472726 6:133624278-133624300 GTCCAGTGGTTAGTTTTGAGAGG - Intergenic
1017716443 6:157217002-157217024 GTTCAGTTGTGGGTTTTGAAAGG + Intergenic
1022098235 7:27154167-27154189 CTCCAGAAGTGGGGGTTGATGGG + Exonic
1024594014 7:50917158-50917180 GTCTAGATGTGGGTGTTGTGAGG + Intergenic
1027499094 7:78925599-78925621 TTCCAGAAGTGTGTGATGAGTGG + Intronic
1028420888 7:90631621-90631643 GTTCAGCAGTTGGTTTGGAGTGG + Intronic
1030199557 7:106888634-106888656 GTACAAAAGTGTGTTTTTAGTGG - Intronic
1032228949 7:130056940-130056962 GGCCAGGAGTAGGTTTTAAGGGG + Intergenic
1037422740 8:18721160-18721182 AGCCAGAAGTGAGTTTTCAGGGG - Intronic
1039509536 8:38079975-38079997 GTCCACAAGTGGATTTTTAAAGG + Intergenic
1044856325 8:96479715-96479737 GTCTAGGTGTGGGTTTTGTGTGG - Intergenic
1046105611 8:109662447-109662469 GACCAGGAGTAGTTTTTGAGAGG - Intronic
1047036216 8:120941395-120941417 GTCAAGAAGTGTGGTGTGAGAGG + Intergenic
1048712647 8:137229112-137229134 TTCGTGAAGTGGCTTTTGAGAGG - Intergenic
1048844731 8:138595571-138595593 GTTAAGGAGTGGGTTTTGGGTGG - Intronic
1050302409 9:4273293-4273315 GTGCAGAAGTGCATTTTAAGTGG - Intronic
1053467349 9:38318588-38318610 GTCCAGAGGTGGGCATGGAGGGG - Intergenic
1054715847 9:68557200-68557222 GTCCAGAAGTGGGATGACAGTGG - Intergenic
1055483002 9:76728250-76728272 GCCCAGAAATGGGTTTTAATGGG - Intronic
1055658768 9:78479651-78479673 GCCCAGATGTGGGTTAGGAGGGG + Intergenic
1056827681 9:89888040-89888062 GTCCATGTGTGGGTTCTGAGTGG + Intergenic
1057794422 9:98145309-98145331 GACCAGAAGTGGGAAGTGAGGGG - Intronic
1059855847 9:118396449-118396471 GTCCAACAATGGGGTTTGAGGGG - Intergenic
1187760839 X:22582272-22582294 TTCCAGAAGAGGATTATGAGGGG + Intergenic
1188386309 X:29563718-29563740 GTTCAGAAGTGAGGTTTGTGTGG - Intronic
1189516250 X:41715930-41715952 GGCCACAAATGGGTTTTGACAGG + Intronic
1189898983 X:45686381-45686403 TTCCCAAAGTGGGTGTTGAGTGG + Intergenic
1190064872 X:47232970-47232992 ATCCGGAAGTGGCTGTTGAGGGG + Exonic
1190260855 X:48795973-48795995 GTTCTGAAGGGGGTTTTTAGAGG - Intergenic
1194401556 X:93443213-93443235 GTGAAGAAGTAGGTGTTGAGTGG + Intergenic
1196714449 X:118798149-118798171 GTGCACAAGTGCGTGTTGAGAGG - Intergenic
1198479863 X:137031361-137031383 GTGCAGAAGTGGCTGTTGAGGGG + Exonic
1200697463 Y:6373693-6373715 GTCCTGCAGTGGGTTTTGGCAGG - Intergenic
1200702582 Y:6414819-6414841 GTCCAGCAATGGGTTTTCACAGG - Intergenic
1200922099 Y:8622470-8622492 ATCCAGAAGAGGGTTTCCAGTGG - Intergenic
1200930390 Y:8691670-8691692 GTCCTGCAGTGGGTTTTCACAGG - Intergenic
1201031528 Y:9749878-9749900 GTCCAGCAATGGGTTTTCACAGG + Intergenic
1201036650 Y:9791006-9791028 GTCCTGCAGTGGGTTTTGGCAGG + Intergenic
1202178463 Y:22119204-22119226 GTCCTGCAGTGGGTTTTCACAGG - Intergenic
1202183228 Y:22157309-22157331 GTCCCAAAGTGGGTTTTCACAGG - Intergenic
1202208131 Y:22429092-22429114 GTCCCAAAGTGGGTTTTCACAGG + Intergenic
1202212898 Y:22467190-22467212 GTCCTGCAGTGGGTTTTCACAGG + Intergenic