ID: 1167126100

View in Genome Browser
Species Human (GRCh38)
Location 19:47549726-47549748
Sequence CAGCATGACCACAATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167126093_1167126100 19 Left 1167126093 19:47549684-47549706 CCACGTGTGGAGGGATGACTGCA 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1167126100 19:47549726-47549748 CAGCATGACCACAATGGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167126100 Original CRISPR CAGCATGACCACAATGGGCT GGG Intronic
900353158 1:2246877-2246899 CAGCCTGGCCACAGTGGGCGAGG - Intronic
902376338 1:16031746-16031768 CAGCATCACCACACTGGCCAAGG + Exonic
902381301 1:16053675-16053697 CAGCATCACCACACTGGCCAAGG + Exonic
902711043 1:18239972-18239994 CAGAATAAGAACAATGGGCTGGG + Intronic
903121099 1:21217598-21217620 CAGCACCAGCACCATGGGCTTGG - Intronic
903222276 1:21875590-21875612 CAGGAGGACCAGCATGGGCTTGG - Intronic
903584553 1:24401598-24401620 CAGCACCAGCACAATGTGCTTGG - Intronic
905084861 1:35363877-35363899 CAGCATGCCCACATTGGGGCAGG - Intronic
909195586 1:72618210-72618232 AAGCATGTACATAATGGGCTTGG + Intergenic
910190071 1:84585959-84585981 GGGCATGCCCACAATGGACTGGG - Intergenic
914783673 1:150808840-150808862 CAGCAAAACCACATTAGGCTGGG - Intergenic
916756354 1:167773959-167773981 CACCATCATCACACTGGGCTGGG - Intronic
923540849 1:234887033-234887055 CAGCATGACCTCAAGGTTCTTGG - Intergenic
923623809 1:235598090-235598112 CAGCTTCCCCACAGTGGGCTGGG - Intronic
923861708 1:237898285-237898307 CAGCAGGAGCAGAATGGCCTGGG + Intergenic
924925998 1:248681561-248681583 GAGCATGATGACAATGAGCTGGG + Exonic
1065849002 10:29771199-29771221 CAGAATGATCACAAAGGGCAGGG + Intergenic
1068194615 10:53699476-53699498 CAGCATGAACACCAAGGGGTAGG + Intergenic
1068417703 10:56745635-56745657 GGGCATGCCCACAATGGACTGGG + Intergenic
1071262806 10:83936133-83936155 CTGCTGGACCACAATGGGTTTGG - Intergenic
1072507869 10:96087943-96087965 CAGAATGAGCACTAGGGGCTTGG + Intergenic
1073250259 10:102116991-102117013 CAGGATGACCAGGGTGGGCTGGG + Intronic
1073498270 10:103913823-103913845 CAGCAGGAACACAAGGGCCTTGG - Intronic
1076399929 10:130175848-130175870 CACCATGCCCACAGTGGGCCTGG - Intronic
1077342930 11:2034011-2034033 CAGCATGGCCCCAGTGGCCTGGG + Intergenic
1079241967 11:18727831-18727853 CAGCATGAGCACAGTGAGCTTGG - Intergenic
1083720350 11:64600732-64600754 CAGGATGACGGCAGTGGGCTTGG + Exonic
1085150706 11:74250973-74250995 CTGCATGGCCACACTGGGGTAGG - Exonic
1086958010 11:92953876-92953898 CAGCATGGCCACCATTGGCTGGG - Intergenic
1086961586 11:92984081-92984103 CTGCATGTCCACAATGTGCCTGG + Intronic
1089218280 11:116849208-116849230 CTGCCGGATCACAATGGGCTCGG - Exonic
1089829663 11:121315761-121315783 TAGCATGGCTACAATGGGATGGG + Intergenic
1090676896 11:129007214-129007236 CAGCTTGGCCACAGTGGGATAGG - Intronic
1202825916 11_KI270721v1_random:89200-89222 CAGCATGGCCCCAGTGGCCTGGG + Intergenic
1092124762 12:6067155-6067177 CAGCACATCCAGAATGGGCTGGG - Intronic
1095395579 12:41758604-41758626 CAACATAACCACAATGAGGTGGG - Intergenic
1099610080 12:84857214-84857236 CAGCTCCGCCACAATGGGCTAGG - Intergenic
1103457811 12:121080038-121080060 CAGCATGACCACCTGGGGCCTGG + Intergenic
1103550677 12:121734968-121734990 CAGCATGTCCAGAATAGCCTGGG - Intronic
1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG + Intronic
1105833905 13:24192116-24192138 GAGCATGGCCACAATGGACTGGG - Intronic
1106285940 13:28318107-28318129 CACCATCACCACACTTGGCTTGG + Intronic
1106841100 13:33685672-33685694 AAGCAGGACCAAAATGGGATAGG - Intergenic
1109113214 13:58349925-58349947 CATCATGAACAAAATGTGCTAGG + Intergenic
1111639321 13:90947445-90947467 CAGCTTGGCCACAGTGGGGTAGG + Intergenic
1113089323 13:106600396-106600418 CAGGATGACCTTCATGGGCTTGG - Intergenic
1116342946 14:43749740-43749762 CAACATGACCACCATGGGTGAGG - Intergenic
1116923808 14:50611700-50611722 CATATTGAACACAATGGGCTAGG + Intronic
1121908920 14:97771320-97771342 CAGCATGACAGCCATGGGTTAGG - Intergenic
1124896659 15:33783815-33783837 CAGCAGGACAACAATGGCCATGG - Intronic
1128292639 15:66489858-66489880 CAGCTGGACCACAGTGGGCAGGG - Intronic
1130821160 15:87497126-87497148 AAGTATGAGTACAATGGGCTTGG + Intergenic
1132500946 16:284456-284478 CAGCGTGACCACCATTGACTCGG - Exonic
1133285108 16:4687035-4687057 CAGCATGGCCACCGTGGGCCTGG + Intronic
1133629275 16:7603902-7603924 CACCATGACCAGAATGGACAGGG + Intronic
1137487775 16:48906151-48906173 CCGGATGACCTCAATGGGCCGGG - Intergenic
1139350135 16:66329733-66329755 CAGGATGACCACAATGGCAGGGG - Intergenic
1140653364 16:77113171-77113193 TAGCATAACTACAATGTGCTTGG - Intergenic
1140816762 16:78628369-78628391 CAGAATGGCCACACGGGGCTTGG - Intronic
1141177545 16:81730720-81730742 CAGGATGCCCAGAATGGGCGGGG + Intergenic
1142154325 16:88526318-88526340 CAGAATGACCTCTGTGGGCTGGG - Intronic
1142197357 16:88745002-88745024 CAGCATGACCTCAAGGGGTCGGG + Intronic
1144739278 17:17572193-17572215 CAGCTTGACCACAGTGGGACTGG - Intronic
1146488936 17:33265985-33266007 CAGCAAGACCACCATGGCCATGG - Intronic
1147051503 17:37798352-37798374 CAGCCTGCCCACAATGGGAGCGG + Intergenic
1147335838 17:39726637-39726659 CTGGATGACCACAAAGCGCTGGG - Exonic
1147623851 17:41886390-41886412 CAGCCTGGCCAGAAGGGGCTGGG - Intronic
1149801363 17:59571160-59571182 AAGTATGTTCACAATGGGCTGGG + Intronic
1150743659 17:67799371-67799393 CAGCAAGACCACAATGGCAGGGG - Intergenic
1153356646 18:4143947-4143969 CAGCACAACCACAGTAGGCTAGG - Intronic
1154031052 18:10754931-10754953 CCGCATGACCTCCTTGGGCTGGG + Intronic
1155416523 18:25605127-25605149 CACCATGAACAGAAGGGGCTGGG + Intergenic
1156128362 18:33936369-33936391 CAGCATGAACCCAATGGCCCAGG - Intronic
1157527446 18:48395103-48395125 CAGCATGACAACAAAGGGTCTGG + Intronic
1161101587 19:2424459-2424481 TAGCCTGACCACACGGGGCTGGG + Intronic
1161957760 19:7506059-7506081 CTTCAAGACCACCATGGGCTCGG + Exonic
1162693022 19:12449448-12449470 CAGCTTGTCCACAGTGGGGTAGG - Intronic
1163262697 19:16200669-16200691 CAGCGTGGCCACACTGGGCTGGG + Intronic
1163385827 19:16999870-16999892 CAGCCTGACCACCATGGCCTGGG - Intronic
1163761227 19:19137801-19137823 CAGCCTGACCCCCAGGGGCTGGG + Intronic
1167126100 19:47549726-47549748 CAGCATGACCACAATGGGCTGGG + Intronic
925557895 2:5152535-5152557 CAGCATGACCACAGAGGCCCAGG - Intergenic
927944764 2:27129031-27129053 AAGCAGCAGCACAATGGGCTGGG - Exonic
936836122 2:116711289-116711311 CAGCAGGACAGCAATGGACTTGG - Intergenic
936944948 2:117921725-117921747 CAGCATGACCACAACGACCTTGG + Intronic
940012908 2:149073495-149073517 CAGCATCACGGCAGTGGGCTTGG - Intronic
940224960 2:151391515-151391537 CAAAATGACCACAATGTTCTTGG + Intergenic
941543830 2:166820425-166820447 CTGAATGCCCACAATGGGCAAGG + Intergenic
944133249 2:196370006-196370028 CAGCTTGTCCACAATGGGTGAGG - Intronic
947181609 2:227416357-227416379 CCTCATAACCACAATGGGCTGGG - Intergenic
947478209 2:230471368-230471390 CAGCATGACCACATTGAGACAGG + Intronic
947984361 2:234436420-234436442 CAGCATGGCCCCAGTGAGCTTGG + Intergenic
1172191360 20:33063722-33063744 CTGTATGACCCCAATGGGGTAGG + Intronic
1173876485 20:46375502-46375524 CAGCAGGACAGAAATGGGCTTGG + Intronic
1176307527 21:5131688-5131710 CAGGATGACCCCAAAGGGATGGG - Intronic
1177149016 21:17436148-17436170 CTGCATGTCCACCATGTGCTAGG - Intergenic
1179849533 21:44130342-44130364 CAGGATGACCCCAAAGGGATGGG + Intronic
1181785180 22:25221656-25221678 CAGCATGCCAGCTATGGGCTGGG - Intronic
1182780168 22:32861317-32861339 TGGCATGACCACAATGGGAAAGG - Exonic
1184349854 22:43936415-43936437 CAGCATTGGCACACTGGGCTGGG - Intronic
1185418424 22:50721973-50721995 CAGCATGTCCACCTTGAGCTCGG + Intergenic
951451712 3:22847252-22847274 CAGCAAGACTACAATGGGTAAGG + Intergenic
952673030 3:35993990-35994012 CAGCTTGACCACAGTGGAGTAGG + Intergenic
953509089 3:43517353-43517375 CAGTAGGACCATAATGGACTGGG - Intronic
954051042 3:47977886-47977908 CTCCATGACCACCATTGGCTAGG + Exonic
959809255 3:110595586-110595608 CAGCATAACCAGAATGACCTTGG + Intergenic
962270669 3:133975719-133975741 CAGCAAGAACAAAAGGGGCTGGG - Intronic
966945024 3:184771630-184771652 CAGCATGACTACACAGGGCTGGG + Intergenic
967971726 3:195004369-195004391 CAGCATGTACACAATGGGACTGG - Intergenic
968706970 4:2083630-2083652 GAGCATCACCACAAAGGGCCAGG - Intronic
970336410 4:15049916-15049938 CAGCCTGAACAGAATGGGTTGGG - Intronic
971311995 4:25533095-25533117 CAGAATGACAAGAATGGGCCGGG - Intergenic
975279176 4:72540634-72540656 CAGCATGACAACGCTGGGCCTGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977744999 4:100535952-100535974 CAGCATGGCCACAGAGGGGTAGG + Intronic
981602041 4:146500841-146500863 CAGCCTGACCACAGTGGTTTTGG - Intronic
982618930 4:157678679-157678701 CAGCATGGGCACCCTGGGCTTGG + Intergenic
983818236 4:172159322-172159344 CTGCATGTCCTCAAAGGGCTTGG - Intronic
984600683 4:181722915-181722937 TAGAAGGACCACAATGGGCCAGG + Intergenic
989047031 5:37283408-37283430 CAGCATGAGAACCCTGGGCTGGG + Intergenic
997203425 5:132026663-132026685 CACCCTGACCACTATGGGGTGGG + Intergenic
1001698730 5:173691427-173691449 CTGAATGACAAGAATGGGCTGGG - Intergenic
1004182770 6:13395312-13395334 CAGCATGACAGCCATGGCCTTGG + Intronic
1005768393 6:29038512-29038534 GAGCATGACCAAATTGGGTTAGG - Intergenic
1014126620 6:117783455-117783477 GAGCATGAACACAATGGGCCTGG + Intergenic
1015995215 6:138989614-138989636 CAGAAAGAGCACAATGGGGTAGG + Intergenic
1016538648 6:145137992-145138014 TAGCATCTCCACAATAGGCTGGG - Intergenic
1017606485 6:156139895-156139917 CAGCATACCCACAATAGGCCAGG - Intergenic
1020936575 7:14473190-14473212 CAGCATGGGCACCCTGGGCTTGG - Intronic
1022469264 7:30672138-30672160 TAGCTTGACCTCAATGGGCTGGG - Intronic
1029738857 7:102480188-102480210 CAGCTAGACCACGGTGGGCTTGG - Intergenic
1029755983 7:102573844-102573866 CAGCTAGACCACGGTGGGCTTGG - Intronic
1032269966 7:130395835-130395857 CAGCACGATCATATTGGGCTTGG - Exonic
1033041252 7:137920314-137920336 CAGCATGAGAAGAATGAGCTAGG + Intronic
1034211527 7:149367667-149367689 CTGCATCACCAGCATGGGCTGGG - Intergenic
1035563868 8:628523-628545 CAGGGTGACCCCAAGGGGCTGGG + Intronic
1039546604 8:38415176-38415198 CAGCAAGTCCACATGGGGCTGGG + Intronic
1041447729 8:57971004-57971026 TAACATGACCAGAATGGCCTGGG + Intergenic
1043650053 8:82579472-82579494 CAGTATGATAACAGTGGGCTGGG - Intergenic
1043850237 8:85208031-85208053 TAAAATGACCACATTGGGCTGGG + Intronic
1047458034 8:125034202-125034224 CAGGATGGCTAAAATGGGCTGGG + Intronic
1051024345 9:12588989-12589011 CACCATGACCACCATGTGTTGGG - Intergenic
1051654238 9:19363317-19363339 CAGCATGGCCAAGATGGTCTTGG + Intronic
1052900009 9:33785470-33785492 AAACTTGACCACAATGGGCCGGG - Intronic
1053815374 9:41901734-41901756 TGGCATGACTTCAATGGGCTGGG - Intronic
1054615222 9:67285706-67285728 TGGCATGACTTCAATGGGCTGGG + Intergenic
1054790676 9:69253738-69253760 CAGAATGGCCACAAGAGGCTGGG - Intronic
1054963138 9:70992172-70992194 CAAAAGGACCACAATGTGCTGGG - Intronic
1055477999 9:76682561-76682583 CAGCCTGACCACCATGGACATGG - Intronic
1062483257 9:136762198-136762220 CAGCATGACCATCATGTCCTTGG + Exonic
1185938870 X:4290757-4290779 CAGCATCGCCATAATTGGCTTGG + Intergenic
1186380512 X:9053899-9053921 CAGGGTGACCACAGTTGGCTGGG - Intronic
1187314817 X:18183544-18183566 CAGCTTGGCCACAGTGGGGTAGG + Intronic
1187986028 X:24812062-24812084 CAGTATGAGCACAATGTGCCAGG - Intronic
1190249096 X:48708672-48708694 CAGGGTGAGCACAAAGGGCTGGG - Exonic
1191250146 X:58256338-58256360 CGGCATGAACCCAGTGGGCTTGG - Intergenic
1195995687 X:110729471-110729493 CAGCATGACCTCAATGTGATGGG - Intronic