ID: 1167129173

View in Genome Browser
Species Human (GRCh38)
Location 19:47573146-47573168
Sequence CCGGGCGGCGCGGGGAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129173_1167129195 26 Left 1167129173 19:47573146-47573168 CCCGCCTTCCCCGCGCCGCCCGG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129173_1167129184 -5 Left 1167129173 19:47573146-47573168 CCCGCCTTCCCCGCGCCGCCCGG No data
Right 1167129184 19:47573164-47573186 CCCGGGGCGCACGCGCAGCCCGG No data
1167129173_1167129186 6 Left 1167129173 19:47573146-47573168 CCCGCCTTCCCCGCGCCGCCCGG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129173 Original CRISPR CCGGGCGGCGCGGGGAAGGC GGG (reversed) Intergenic