ID: 1167129178

View in Genome Browser
Species Human (GRCh38)
Location 19:47573150-47573172
Sequence CGCCCCGGGCGGCGCGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129178_1167129196 28 Left 1167129178 19:47573150-47573172 CCTTCCCCGCGCCGCCCGGGGCG No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129178_1167129186 2 Left 1167129178 19:47573150-47573172 CCTTCCCCGCGCCGCCCGGGGCG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129178_1167129195 22 Left 1167129178 19:47573150-47573172 CCTTCCCCGCGCCGCCCGGGGCG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129178_1167129184 -9 Left 1167129178 19:47573150-47573172 CCTTCCCCGCGCCGCCCGGGGCG No data
Right 1167129184 19:47573164-47573186 CCCGGGGCGCACGCGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129178 Original CRISPR CGCCCCGGGCGGCGCGGGGA AGG (reversed) Intergenic