ID: 1167129179

View in Genome Browser
Species Human (GRCh38)
Location 19:47573154-47573176
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129179_1167129195 18 Left 1167129179 19:47573154-47573176 CCCCGCGCCGCCCGGGGCGCACG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129179_1167129196 24 Left 1167129179 19:47573154-47573176 CCCCGCGCCGCCCGGGGCGCACG No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129179_1167129186 -2 Left 1167129179 19:47573154-47573176 CCCCGCGCCGCCCGGGGCGCACG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129179 Original CRISPR CGTGCGCCCCGGGCGGCGCG GGG (reversed) Intergenic