ID: 1167129182 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:47573161-47573183 |
| Sequence | GGCTGCGCGTGCGCCCCGGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1167129182_1167129195 | 11 | Left | 1167129182 | 19:47573161-47573183 | CCGCCCGGGGCGCACGCGCAGCC | No data | ||
| Right | 1167129195 | 19:47573195-47573217 | CGGATCTCCTCGCTCACGCGCGG | No data | ||||
| 1167129182_1167129196 | 17 | Left | 1167129182 | 19:47573161-47573183 | CCGCCCGGGGCGCACGCGCAGCC | No data | ||
| Right | 1167129196 | 19:47573201-47573223 | TCCTCGCTCACGCGCGGCGCAGG | No data | ||||
| 1167129182_1167129186 | -9 | Left | 1167129182 | 19:47573161-47573183 | CCGCCCGGGGCGCACGCGCAGCC | No data | ||
| Right | 1167129186 | 19:47573175-47573197 | CGCGCAGCCCGGCCCACCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1167129182 | Original CRISPR | GGCTGCGCGTGCGCCCCGGG CGG (reversed) | Intergenic | ||