ID: 1167129183 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:47573164-47573186 |
Sequence | CCGGGCTGCGCGTGCGCCCC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167129183_1167129196 | 14 | Left | 1167129183 | 19:47573164-47573186 | CCCGGGGCGCACGCGCAGCCCGG | No data | ||
Right | 1167129196 | 19:47573201-47573223 | TCCTCGCTCACGCGCGGCGCAGG | No data | ||||
1167129183_1167129195 | 8 | Left | 1167129183 | 19:47573164-47573186 | CCCGGGGCGCACGCGCAGCCCGG | No data | ||
Right | 1167129195 | 19:47573195-47573217 | CGGATCTCCTCGCTCACGCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167129183 | Original CRISPR | CCGGGCTGCGCGTGCGCCCC GGG (reversed) | Intergenic | ||