ID: 1167129183

View in Genome Browser
Species Human (GRCh38)
Location 19:47573164-47573186
Sequence CCGGGCTGCGCGTGCGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129183_1167129196 14 Left 1167129183 19:47573164-47573186 CCCGGGGCGCACGCGCAGCCCGG No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129183_1167129195 8 Left 1167129183 19:47573164-47573186 CCCGGGGCGCACGCGCAGCCCGG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129183 Original CRISPR CCGGGCTGCGCGTGCGCCCC GGG (reversed) Intergenic