ID: 1167129185

View in Genome Browser
Species Human (GRCh38)
Location 19:47573165-47573187
Sequence GCCGGGCTGCGCGTGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129185_1167129195 7 Left 1167129185 19:47573165-47573187 CCGGGGCGCACGCGCAGCCCGGC No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129185_1167129196 13 Left 1167129185 19:47573165-47573187 CCGGGGCGCACGCGCAGCCCGGC No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129185 Original CRISPR GCCGGGCTGCGCGTGCGCCC CGG (reversed) Intergenic