ID: 1167129186

View in Genome Browser
Species Human (GRCh38)
Location 19:47573175-47573197
Sequence CGCGCAGCCCGGCCCACCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129169_1167129186 29 Left 1167129169 19:47573123-47573145 CCTCGCGGGGCTCCCAGCGGCCT No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129178_1167129186 2 Left 1167129178 19:47573150-47573172 CCTTCCCCGCGCCGCCCGGGGCG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129172_1167129186 9 Left 1167129172 19:47573143-47573165 CCTCCCGCCTTCCCCGCGCCGCC No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129170_1167129186 17 Left 1167129170 19:47573135-47573157 CCCAGCGGCCTCCCGCCTTCCCC No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129181_1167129186 -4 Left 1167129181 19:47573156-47573178 CCGCGCCGCCCGGGGCGCACGCG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129175_1167129186 5 Left 1167129175 19:47573147-47573169 CCGCCTTCCCCGCGCCGCCCGGG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129171_1167129186 16 Left 1167129171 19:47573136-47573158 CCAGCGGCCTCCCGCCTTCCCCG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129180_1167129186 -3 Left 1167129180 19:47573155-47573177 CCCGCGCCGCCCGGGGCGCACGC No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129182_1167129186 -9 Left 1167129182 19:47573161-47573183 CCGCCCGGGGCGCACGCGCAGCC No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129179_1167129186 -2 Left 1167129179 19:47573154-47573176 CCCCGCGCCGCCCGGGGCGCACG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data
1167129173_1167129186 6 Left 1167129173 19:47573146-47573168 CCCGCCTTCCCCGCGCCGCCCGG No data
Right 1167129186 19:47573175-47573197 CGCGCAGCCCGGCCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129186 Original CRISPR CGCGCAGCCCGGCCCACCCC CGG Intergenic