ID: 1167129187

View in Genome Browser
Species Human (GRCh38)
Location 19:47573182-47573204
Sequence AGGAGATCCGGGGGTGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129187_1167129198 15 Left 1167129187 19:47573182-47573204 CCCGGCCCACCCCCGGATCTCCT No data
Right 1167129198 19:47573220-47573242 CAGGCGCGCGTACGTGACCGCGG No data
1167129187_1167129199 16 Left 1167129187 19:47573182-47573204 CCCGGCCCACCCCCGGATCTCCT No data
Right 1167129199 19:47573221-47573243 AGGCGCGCGTACGTGACCGCGGG No data
1167129187_1167129195 -10 Left 1167129187 19:47573182-47573204 CCCGGCCCACCCCCGGATCTCCT No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129187_1167129196 -4 Left 1167129187 19:47573182-47573204 CCCGGCCCACCCCCGGATCTCCT No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129187 Original CRISPR AGGAGATCCGGGGGTGGGCC GGG (reversed) Intergenic