ID: 1167129187 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:47573182-47573204 |
| Sequence | AGGAGATCCGGGGGTGGGCC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1167129187_1167129198 | 15 | Left | 1167129187 | 19:47573182-47573204 | CCCGGCCCACCCCCGGATCTCCT | No data | ||
| Right | 1167129198 | 19:47573220-47573242 | CAGGCGCGCGTACGTGACCGCGG | No data | ||||
| 1167129187_1167129199 | 16 | Left | 1167129187 | 19:47573182-47573204 | CCCGGCCCACCCCCGGATCTCCT | No data | ||
| Right | 1167129199 | 19:47573221-47573243 | AGGCGCGCGTACGTGACCGCGGG | No data | ||||
| 1167129187_1167129195 | -10 | Left | 1167129187 | 19:47573182-47573204 | CCCGGCCCACCCCCGGATCTCCT | No data | ||
| Right | 1167129195 | 19:47573195-47573217 | CGGATCTCCTCGCTCACGCGCGG | No data | ||||
| 1167129187_1167129196 | -4 | Left | 1167129187 | 19:47573182-47573204 | CCCGGCCCACCCCCGGATCTCCT | No data | ||
| Right | 1167129196 | 19:47573201-47573223 | TCCTCGCTCACGCGCGGCGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1167129187 | Original CRISPR | AGGAGATCCGGGGGTGGGCC GGG (reversed) | Intergenic | ||