ID: 1167129195

View in Genome Browser
Species Human (GRCh38)
Location 19:47573195-47573217
Sequence CGGATCTCCTCGCTCACGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129180_1167129195 17 Left 1167129180 19:47573155-47573177 CCCGCGCCGCCCGGGGCGCACGC No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129182_1167129195 11 Left 1167129182 19:47573161-47573183 CCGCCCGGGGCGCACGCGCAGCC No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129173_1167129195 26 Left 1167129173 19:47573146-47573168 CCCGCCTTCCCCGCGCCGCCCGG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129179_1167129195 18 Left 1167129179 19:47573154-47573176 CCCCGCGCCGCCCGGGGCGCACG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129185_1167129195 7 Left 1167129185 19:47573165-47573187 CCGGGGCGCACGCGCAGCCCGGC No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129175_1167129195 25 Left 1167129175 19:47573147-47573169 CCGCCTTCCCCGCGCCGCCCGGG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129183_1167129195 8 Left 1167129183 19:47573164-47573186 CCCGGGGCGCACGCGCAGCCCGG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129178_1167129195 22 Left 1167129178 19:47573150-47573172 CCTTCCCCGCGCCGCCCGGGGCG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129181_1167129195 16 Left 1167129181 19:47573156-47573178 CCGCGCCGCCCGGGGCGCACGCG No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129187_1167129195 -10 Left 1167129187 19:47573182-47573204 CCCGGCCCACCCCCGGATCTCCT No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data
1167129172_1167129195 29 Left 1167129172 19:47573143-47573165 CCTCCCGCCTTCCCCGCGCCGCC No data
Right 1167129195 19:47573195-47573217 CGGATCTCCTCGCTCACGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129195 Original CRISPR CGGATCTCCTCGCTCACGCG CGG Intergenic