ID: 1167129196

View in Genome Browser
Species Human (GRCh38)
Location 19:47573201-47573223
Sequence TCCTCGCTCACGCGCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167129188_1167129196 -5 Left 1167129188 19:47573183-47573205 CCGGCCCACCCCCGGATCTCCTC No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129189_1167129196 -9 Left 1167129189 19:47573187-47573209 CCCACCCCCGGATCTCCTCGCTC No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129182_1167129196 17 Left 1167129182 19:47573161-47573183 CCGCCCGGGGCGCACGCGCAGCC No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129185_1167129196 13 Left 1167129185 19:47573165-47573187 CCGGGGCGCACGCGCAGCCCGGC No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129190_1167129196 -10 Left 1167129190 19:47573188-47573210 CCACCCCCGGATCTCCTCGCTCA No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129187_1167129196 -4 Left 1167129187 19:47573182-47573204 CCCGGCCCACCCCCGGATCTCCT No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129178_1167129196 28 Left 1167129178 19:47573150-47573172 CCTTCCCCGCGCCGCCCGGGGCG No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129181_1167129196 22 Left 1167129181 19:47573156-47573178 CCGCGCCGCCCGGGGCGCACGCG No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129179_1167129196 24 Left 1167129179 19:47573154-47573176 CCCCGCGCCGCCCGGGGCGCACG No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129180_1167129196 23 Left 1167129180 19:47573155-47573177 CCCGCGCCGCCCGGGGCGCACGC No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data
1167129183_1167129196 14 Left 1167129183 19:47573164-47573186 CCCGGGGCGCACGCGCAGCCCGG No data
Right 1167129196 19:47573201-47573223 TCCTCGCTCACGCGCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167129196 Original CRISPR TCCTCGCTCACGCGCGGCGC AGG Intergenic