ID: 1167133685

View in Genome Browser
Species Human (GRCh38)
Location 19:47604004-47604026
Sequence AAACTGAGGCTCGCAAACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167133678_1167133685 14 Left 1167133678 19:47603967-47603989 CCTGGGAACTGCCAAAAAGGGCA No data
Right 1167133685 19:47604004-47604026 AAACTGAGGCTCGCAAACCGAGG No data
1167133675_1167133685 23 Left 1167133675 19:47603958-47603980 CCAAAGGAACCTGGGAACTGCCA No data
Right 1167133685 19:47604004-47604026 AAACTGAGGCTCGCAAACCGAGG No data
1167133681_1167133685 3 Left 1167133681 19:47603978-47604000 CCAAAAAGGGCATGACCAAGGGA No data
Right 1167133685 19:47604004-47604026 AAACTGAGGCTCGCAAACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167133685 Original CRISPR AAACTGAGGCTCGCAAACCG AGG Intergenic
No off target data available for this crispr