ID: 1167134347

View in Genome Browser
Species Human (GRCh38)
Location 19:47608409-47608431
Sequence TCGAGGATGAAGGAAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167134347_1167134355 3 Left 1167134347 19:47608409-47608431 CCCTCCATTTCCTTCATCCTCGA 0: 1
1: 0
2: 0
3: 23
4: 261
Right 1167134355 19:47608435-47608457 CCGCTATCTTTTCGGACCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 21
1167134347_1167134356 15 Left 1167134347 19:47608409-47608431 CCCTCCATTTCCTTCATCCTCGA 0: 1
1: 0
2: 0
3: 23
4: 261
Right 1167134356 19:47608447-47608469 CGGACCTGCGGCGCTCCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 79
1167134347_1167134352 -5 Left 1167134347 19:47608409-47608431 CCCTCCATTTCCTTCATCCTCGA 0: 1
1: 0
2: 0
3: 23
4: 261
Right 1167134352 19:47608427-47608449 CTCGACTCCCGCTATCTTTTCGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167134347 Original CRISPR TCGAGGATGAAGGAAATGGA GGG (reversed) Intronic
901157746 1:7151704-7151726 TCGAGGACGGAGGACATGGCAGG + Intronic
901438513 1:9263766-9263788 TCCAGCTGGAAGGAAATGGAGGG + Exonic
904440734 1:30527874-30527896 TGGAAGATGAAGGACAGGGAGGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906073416 1:43034454-43034476 TAAAGGAAGAAGGAAAGGGAAGG - Intergenic
907732197 1:57077416-57077438 TACAGGATGAAGGAAATGAATGG + Intronic
908260236 1:62334643-62334665 GATAGGCTGAAGGAAATGGAAGG + Intergenic
908429641 1:64043310-64043332 TGGTTGATGAAGTAAATGGAAGG - Intronic
909359673 1:74745801-74745823 TCCAGGATGAAGGTACTGGCAGG + Intronic
909701628 1:78531000-78531022 TCAAGGAAGGAGGAAAGGGAAGG - Intronic
910865531 1:91784882-91784904 TAGAGGATGAAGACAATGAAGGG - Intronic
913053637 1:115138370-115138392 TGGAGGATAAAGGAAATAGAGGG - Intergenic
913166366 1:116190647-116190669 AAGAGGATGAGGGAAATGGCAGG - Intergenic
914146357 1:144998565-144998587 AAGAGGAAGAAGGAAAAGGAAGG + Intronic
915138135 1:153748492-153748514 TCCAGAAAGAAGGAAAGGGAAGG - Intronic
915565484 1:156710514-156710536 TGGAGGAAGAAGGAAAAGGTTGG + Intergenic
917621803 1:176803690-176803712 GAGAGAATGAAGGAAATTGATGG - Intronic
918357577 1:183720053-183720075 TGGAAGATGAAGGTAAAGGATGG + Intronic
919224457 1:194677337-194677359 CAGAGAATGAAGGAAATGCAAGG - Intergenic
921823978 1:219650838-219650860 TTGAGGATAATGGAAATAGATGG - Intergenic
922714124 1:227857675-227857697 TAGGGGATGAAGGGAAGGGAAGG + Intergenic
923397061 1:233576622-233576644 TAGAGGATGAAGGAATTTTAAGG - Intergenic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
1063866792 10:10373861-10373883 TGGAGCATGAAGGAAAGTGAGGG + Intergenic
1063905614 10:10777461-10777483 TTGAGGATGAAGGAGATAGAGGG - Intergenic
1064193787 10:13229280-13229302 TGGAGGAGGGAGGAAAGGGAAGG - Intronic
1065527032 10:26633225-26633247 TAGAGGATGAAGGAAAAGCAAGG + Intergenic
1065851226 10:29791414-29791436 TGGAGGATGAGTGAAATAGATGG - Intergenic
1069632604 10:69906031-69906053 GCCAGGATGTAGGACATGGAGGG + Intronic
1070370443 10:75777278-75777300 TTGAAGACAAAGGAAATGGAAGG - Intronic
1070387367 10:75938031-75938053 TGGAGGATGGAGGAAATTGTAGG + Intronic
1070568200 10:77619896-77619918 TGGAGGATGGAGGAGGTGGAGGG + Intronic
1070818372 10:79339634-79339656 TGGAGGAAGAAGGGAGTGGAGGG - Intergenic
1072080412 10:92024354-92024376 TCAAGGATTGAGGAAAAGGAAGG + Intronic
1072417198 10:95259033-95259055 AGGAGGATGAGGGAAAAGGAGGG + Intronic
1072526056 10:96272581-96272603 TCAAGGAGGAAGAAAATGGGAGG + Intergenic
1075245793 10:120821251-120821273 AGGAGGAAGAAGGAAATGAAAGG - Intergenic
1078008612 11:7551995-7552017 TGGAGGACTAAGGAAATGGAAGG - Intronic
1078657714 11:13257633-13257655 TCAAGGATGAAGGACATAAATGG + Intergenic
1079186568 11:18243701-18243723 TCAAGGAGGAAGAAAATGTATGG - Intronic
1080754703 11:35185614-35185636 AAGAGGAAGAAGGAGATGGATGG - Intronic
1082854327 11:57792913-57792935 TGGAGGATCAAGGAATTTGAGGG + Intronic
1083178681 11:60970677-60970699 GCAAGGATGCAGGAAGTGGAGGG + Intergenic
1083409103 11:62479708-62479730 TCGTGGAAGAAGGGAATGGAAGG - Intronic
1085336803 11:75702641-75702663 TTGTGGATGATGTAAATGGAAGG - Intergenic
1085614450 11:77985196-77985218 TGGAGGATAAAGGAATTGGATGG - Intronic
1085662046 11:78377249-78377271 TCCAGGATGAAGGAACTAGTAGG + Intronic
1086042749 11:82498704-82498726 ATGAGGATGTAAGAAATGGAAGG + Intergenic
1086363042 11:86079021-86079043 TAGAGGAAGAAGGAAAGAGATGG - Intergenic
1087237976 11:95741512-95741534 CCCAGGATGAAGAAAAGGGAAGG - Intergenic
1087510550 11:99086959-99086981 TCATAGATGAAGAAAATGGAGGG + Intronic
1088562408 11:111128786-111128808 TCCAGCATCAATGAAATGGATGG + Intergenic
1088982402 11:114875550-114875572 GAGAGGATGAAGGAACTGGGTGG - Intergenic
1089255487 11:117191856-117191878 TCTAGGATGAGGGACACGGAAGG - Exonic
1090081955 11:123619331-123619353 TGGAGGAAGAATGAATTGGAGGG - Intronic
1090856160 11:130610802-130610824 TCCAAGATGAAGGAAAAAGATGG - Intergenic
1090943041 11:131405458-131405480 TTAAGGGTGAAGGAAAGGGAAGG - Intronic
1092518252 12:9238515-9238537 TCTGAGATGAAGGAAATTGAGGG + Intergenic
1095125044 12:38466977-38466999 TGGAGGAAGAAGCAAATGCATGG - Intergenic
1095839358 12:46675443-46675465 TTGGGGATGAGGGAAGTGGAGGG + Intergenic
1096420916 12:51456930-51456952 TCTTGGAGGAAGGAAATGTAGGG + Intronic
1099565497 12:84239520-84239542 TCAAGGATGAACTAAATGGCTGG + Intergenic
1100145829 12:91676349-91676371 TCAAAGATGAAGGAAATGCCAGG + Intergenic
1100286442 12:93171504-93171526 TCAAGGATGTAGAAAATAGATGG + Intergenic
1100604440 12:96140077-96140099 TCAAGAATGAAGGAAGAGGAAGG + Intergenic
1101230038 12:102731422-102731444 TTGAAGATGATGGAAATGAAAGG + Intergenic
1101547681 12:105731984-105732006 CCGAGAATGAAGGAAAGGGAAGG - Intergenic
1101916285 12:108898636-108898658 TCAAGGATGAAGGAAAATGAAGG - Intronic
1102375731 12:112419322-112419344 TCGGGGAGGCAGGAAATGAATGG - Intronic
1102637249 12:114335290-114335312 GAGAGGAAGAAGGAAATTGAGGG - Intergenic
1106598319 13:31165831-31165853 TGGAGGAAGAAGAAGATGGAGGG - Intergenic
1106808110 13:33332233-33332255 TCTAGGCAGAAGGAAAAGGACGG - Intronic
1108407003 13:50114566-50114588 CTGAGGATGCAGGATATGGAGGG - Intronic
1109081530 13:57908230-57908252 TCAAGTATGTGGGAAATGGAGGG - Intergenic
1112865063 13:103884979-103885001 TAGAGGATGAAAAAAATAGAAGG + Intergenic
1115445813 14:33488232-33488254 TAGAGGTTTTAGGAAATGGAAGG + Intronic
1115762603 14:36590451-36590473 TCGAGGATGGAACAAAGGGAAGG + Intergenic
1117726375 14:58678770-58678792 TTGAGGAGGAGAGAAATGGAGGG + Intergenic
1120213426 14:81656929-81656951 ATGAGGTTAAAGGAAATGGATGG + Intergenic
1121222601 14:92297883-92297905 AAGAGGATGAGGGAAAAGGAAGG - Intergenic
1121819126 14:96951683-96951705 GCCGTGATGAAGGAAATGGATGG + Intergenic
1124529185 15:30488597-30488619 AGGGGGAAGAAGGAAATGGAGGG - Intergenic
1124769477 15:32519096-32519118 AGGGGGAAGAAGGAAATGGAGGG + Intergenic
1124837769 15:33212223-33212245 ATGAGGATGAAGGGAAAGGAAGG - Intergenic
1126645238 15:50869099-50869121 TCCAGGAAGAGGGAAAAGGATGG - Intergenic
1127501864 15:59561225-59561247 AGGAGGATGTAGGATATGGATGG + Intergenic
1129323026 15:74785169-74785191 ACGACAATGAAGGAAAAGGATGG - Intronic
1131105171 15:89729031-89729053 GCTAGGAAGAAGGAAATAGAAGG - Exonic
1133468610 16:6052210-6052232 CCTACTATGAAGGAAATGGAAGG - Intronic
1136234185 16:28904324-28904346 CCGAGGGGGAAGGAAAGGGAAGG - Exonic
1139626440 16:68193033-68193055 TCTAGGGGGAAGAAAATGGATGG + Intronic
1139692919 16:68652475-68652497 TGGAGGATGATGGAAGAGGAGGG + Intronic
1141036525 16:80630942-80630964 TGGAGGATGAAGTCAAGGGATGG - Intronic
1141803059 16:86323990-86324012 TCCAGGATGGAGGGAAGGGAAGG + Intergenic
1203143545 16_KI270728v1_random:1784464-1784486 TGGAGGATGCCAGAAATGGAAGG - Intergenic
1143176867 17:4960420-4960442 TGGGGGAGGAAGGAAATGGGTGG - Intronic
1144072467 17:11687059-11687081 ACTAGGAGGAAAGAAATGGAAGG - Intronic
1144294889 17:13864714-13864736 TAGCACATGAAGGAAATGGACGG + Intergenic
1144301163 17:13923855-13923877 TCGAGGATAAAATAAGTGGAAGG + Intergenic
1145718437 17:27045617-27045639 TCAAGGATGAAGGCAAAAGATGG - Intergenic
1146066024 17:29636107-29636129 TCAAGGATGGAGGAACTGGGTGG - Exonic
1146529557 17:33596687-33596709 AAGAGGATGAAGGAAAAGGAAGG - Intronic
1146841635 17:36160409-36160431 CCGCTGATGAAGGAAATGAAGGG + Intergenic
1147080667 17:38017751-38017773 CCGCTGATGAAGGAAATGAAGGG + Intronic
1147462491 17:40582325-40582347 ACCAGGATGAAGAAAAGGGAAGG + Intergenic
1149143491 17:53461815-53461837 TCATGGATGAAGGCAAAGGAAGG + Intergenic
1149600832 17:57892082-57892104 CGGAGGAGGAAGGAAAGGGAGGG - Intronic
1151016955 17:70566104-70566126 TTGAGGATGAATGAATTAGATGG - Intergenic
1151345722 17:73500206-73500228 GGGAGGATGGAGGAGATGGAGGG - Intronic
1151345755 17:73500328-73500350 GGGAGGATGGAGGAGATGGAGGG - Intronic
1151345784 17:73500443-73500465 TGGAGGATGGAGGAGATGGAGGG - Intronic
1151345886 17:73500880-73500902 TGGAGGATGGAGGAGATGGAGGG - Intronic
1153148993 18:2068404-2068426 TCGAGGATGAAGGAGGCAGAAGG + Intergenic
1155362829 18:25018922-25018944 TGGAGTATGAAGGAAAAAGAGGG - Intergenic
1155820640 18:30370842-30370864 TCGCAGATGAGGGCAATGGAGGG - Intergenic
1155971650 18:32089061-32089083 TTGAGGGTTAAGGAATTGGAAGG + Intergenic
1156183698 18:34637139-34637161 TCCAAGAGAAAGGAAATGGATGG + Intronic
1156952722 18:42922832-42922854 TGCAGCCTGAAGGAAATGGATGG + Intronic
1157154101 18:45248151-45248173 TGGAAGAGGAAGGAAATGTAGGG + Intronic
1157814730 18:50722366-50722388 GGGAGGATGAAGGAAAGAGAGGG - Intronic
1158841647 18:61394458-61394480 GCGAGGATGAAGGCAATGATTGG + Intronic
1159520721 18:69518273-69518295 AGGAGGAAGAAGGAAAGGGAAGG - Intronic
1160075417 18:75670500-75670522 CCGTGGATGAAAGGAATGGAAGG - Intergenic
1160931170 19:1570229-1570251 TAAAGGATGAAAGAAAAGGAAGG - Intergenic
1161016828 19:1987428-1987450 TCGGGGATGACGGAGATGGGGGG - Intronic
1162066044 19:8126101-8126123 TTGAGGAGGAAGGAAGGGGACGG + Intronic
1164400660 19:27900074-27900096 ACAAGGATGATGGAAATGGGTGG - Intergenic
1165001493 19:32767046-32767068 GCCAGGAGGGAGGAAATGGAAGG - Intronic
1165121387 19:33561103-33561125 TCCAGGCTGAAGGAGCTGGAGGG + Intergenic
1165800152 19:38544335-38544357 ACAAGGATTATGGAAATGGAAGG - Intronic
1166652156 19:44582732-44582754 ACGAGGAAGAAGGAGAAGGAGGG + Intergenic
1166917978 19:46208763-46208785 TGGAGGGTGAAGGAAAAGCAAGG - Intergenic
1166981785 19:46635585-46635607 GAGAGGATGGAGGAGATGGACGG + Intergenic
1166981844 19:46635731-46635753 GAGAGGATGGAGGAGATGGAGGG + Intergenic
1166981858 19:46635770-46635792 GAGAGGATGGAGGAGATGGACGG + Intergenic
1167134347 19:47608409-47608431 TCGAGGATGAAGGAAATGGAGGG - Intronic
925941905 2:8828775-8828797 TCAAGGGTGGAGGAAAAGGAAGG - Intronic
928062392 2:28127716-28127738 CCCAGGATGAAGGAAAAGAAGGG + Intronic
929265461 2:39914127-39914149 TTTAGGTTGAAGGAAAGGGAAGG - Intergenic
930166749 2:48210610-48210632 TGGAAGATGAAGGAGATGAATGG - Intergenic
931417035 2:62091241-62091263 TCCAGGAAGAGGGAAAAGGATGG - Intronic
932455079 2:71844317-71844339 TCCTGGCTGAAGGACATGGAAGG - Intergenic
932671258 2:73739730-73739752 CCGAGGATGCAGGAAGTGTAAGG - Intergenic
935597212 2:104888614-104888636 ACGAGAAGGAAGGAAATTGAGGG + Intergenic
935685500 2:105679368-105679390 TCCAGGATGCAGGGAATGGTGGG - Intergenic
936381116 2:111987011-111987033 TCTGAGATGAAGGAAATTGAAGG - Intronic
938775850 2:134540533-134540555 TCCAGGAGGAAGGAGAGGGAAGG + Intronic
939360011 2:141159283-141159305 TGGAGGAGGAAAGAATTGGAAGG + Intronic
940360214 2:152788638-152788660 TGGAGGAGGAAGTAAATGGTGGG + Intergenic
942810698 2:179996659-179996681 TGGAGGATGAAGGAAAAAAAAGG + Intronic
945621248 2:212141573-212141595 TGGAGGCTGAAGGAAATTGGAGG - Intronic
946288309 2:218722410-218722432 TAGTGGAGGAATGAAATGGAGGG + Intronic
946569944 2:221013571-221013593 TGGAGTTTGTAGGAAATGGAGGG - Intergenic
947567148 2:231201438-231201460 AGGAGGATGAAGAAACTGGAGGG - Intronic
948437674 2:237965270-237965292 TGGAGGAAGAAGGAAGAGGAGGG + Intergenic
1172088940 20:32413312-32413334 TGGAGGGGGATGGAAATGGAAGG + Intronic
1173497377 20:43529336-43529358 GTGAGGATGAAGTACATGGACGG - Exonic
1173842558 20:46167563-46167585 TAGAGGATGAAAGAAATGAGAGG - Intergenic
1174296644 20:49550079-49550101 ACGAGGATGAAGGAGAAGCACGG - Exonic
1174679317 20:52389902-52389924 TGGAGGCTGAGGGAAAGGGATGG + Intergenic
1175779048 20:61670750-61670772 ACGAGGATGAGGGAAAGGGATGG + Intronic
1178536033 21:33411216-33411238 CGGAAAATGAAGGAAATGGAAGG + Intronic
1179380610 21:40895700-40895722 TACAGGAAGAAGGAAATGGTAGG + Intergenic
1182016777 22:27046958-27046980 ACCAGGATGATGGAAATGTAGGG + Intergenic
949463702 3:4321828-4321850 TTGAGGGTGGAGGAAAGGGAGGG + Intronic
950472234 3:13193464-13193486 TGGGGGATGAAGGATGTGGACGG + Intergenic
950629697 3:14274310-14274332 TCAGGGATGGAGTAAATGGAAGG - Intergenic
951580909 3:24161456-24161478 TAGAGGAAGAAAGAGATGGAGGG + Intronic
951608638 3:24465937-24465959 TCTAGGAAGGAAGAAATGGAAGG - Intronic
952998705 3:38910002-38910024 TAGAGGGGGAAGGAAAAGGATGG + Intronic
955415718 3:58689237-58689259 TTGGGGAAGAAGGAAATAGAGGG + Intergenic
956096434 3:65721249-65721271 TCAAGGAAGATGGAAAGGGAGGG - Intronic
957432341 3:80127032-80127054 TCTAGGAGGAGGGAAAAGGACGG - Intergenic
958098435 3:88977320-88977342 TTGAGGAGGAAACAAATGGAAGG + Intergenic
958536606 3:95412002-95412024 AGGAGGAAGAAGGAAAAGGAAGG - Intergenic
959829888 3:110848426-110848448 TTGATGTAGAAGGAAATGGATGG - Intergenic
960014595 3:112872091-112872113 TCCAGGACAAAGGGAATGGAAGG - Intergenic
960388804 3:117051571-117051593 TCGAAGATGAAGCAACTTGAAGG - Intronic
960390252 3:117069448-117069470 TACAGGAAGAAGGATATGGAAGG + Intronic
960616322 3:119599314-119599336 TCTAGGCTGATGGAAGTGGAGGG + Intronic
960869516 3:122234512-122234534 TGGAGGATGGAGGAAAAAGAGGG + Intronic
960901569 3:122559300-122559322 TAGAGGATGAATGAAAAGAAGGG - Intronic
962184396 3:133243080-133243102 TGGAAGATGAATGAGATGGAAGG + Intronic
962613539 3:137102087-137102109 TCCAAGATGAAGGAATTGGTGGG - Intergenic
963111316 3:141690557-141690579 TAGAAGATGAGGGAAGTGGAAGG - Intergenic
963197225 3:142545780-142545802 AAAAGGATAAAGGAAATGGAGGG + Intronic
965611934 3:170553607-170553629 TCAAGGATGATGGAAATGTCCGG + Intronic
967389610 3:188942761-188942783 GGGAGGAAAAAGGAAATGGAAGG - Intergenic
967440263 3:189499649-189499671 TGGGGGATGGAGAAAATGGAGGG + Intergenic
969335864 4:6509912-6509934 TGGAGGGTGCAGGAAAGGGAGGG - Intronic
969483884 4:7460966-7460988 ACGAGGATGATGGAAAGAGAGGG - Intronic
974855806 4:67459440-67459462 CCGACAATGAAGGAAAAGGAGGG - Intergenic
975250719 4:72175099-72175121 TCCAGGAAGAGGGAAAAGGATGG + Intergenic
975639754 4:76488570-76488592 TGGAGGATGCTGGAAATGGTGGG - Intronic
977345021 4:95806934-95806956 TAGAGAGTGAAGGAGATGGATGG + Intergenic
979081670 4:116351619-116351641 GAGGTGATGAAGGAAATGGAAGG - Intergenic
982565615 4:156982824-156982846 TAGAAGATGTTGGAAATGGAAGG - Intergenic
983665815 4:170181056-170181078 TTGAAGAAGAAAGAAATGGAAGG + Intergenic
983696363 4:170537319-170537341 TGGAGGCTGAAGGGGATGGATGG - Intergenic
983937801 4:173515125-173515147 TGGGGCAGGAAGGAAATGGAAGG + Intergenic
984963716 4:185122765-185122787 CAGTGGATGAAGGAAAGGGAAGG - Intergenic
986218775 5:5747340-5747362 TCCAGGATGTATGGAATGGATGG - Intergenic
987396827 5:17432053-17432075 GGGAGGAGGAAGGAAAGGGAAGG - Intergenic
988497675 5:31758698-31758720 ATGAGGATGGAGGAAAGGGAGGG - Intronic
989719890 5:44512951-44512973 TCAATGCTGAAGGAAATGTATGG + Intergenic
990514327 5:56517712-56517734 TCAAAGATGCAGGAAATAGATGG - Intronic
990874498 5:60468926-60468948 TTGAAGATGCAGGAAATGGTGGG - Intronic
992255335 5:74915328-74915350 TGGAGTTTGAAAGAAATGGAGGG + Intergenic
993127173 5:83850020-83850042 TCTATGAGGAAGGAAATGAATGG + Intergenic
994411618 5:99413595-99413617 TCAAGGAGGAAGGAATGGGATGG - Intergenic
994482208 5:100351655-100351677 TCAAGGAGGAAGGAATGGGATGG + Intergenic
996139521 5:119888769-119888791 TGGGGGATAAAGAAAATGGAGGG + Intergenic
997488684 5:134254150-134254172 TGGAGGATGGAGTATATGGAGGG - Intergenic
998487007 5:142511688-142511710 CAGAGGATGAATTAAATGGAAGG + Intergenic
999746063 5:154592903-154592925 TCGAGGGTGGGGGAAATGGGGGG - Intergenic
1000288272 5:159846553-159846575 GGGAGGAGGAAGGCAATGGAGGG + Intergenic
1001427472 5:171632959-171632981 TTTAGGAATAAGGAAATGGAAGG - Intergenic
1001936326 5:175708384-175708406 TGCAGGATGAAGGAAAGGAAAGG + Intergenic
1002103023 5:176866642-176866664 GAGAGGATGAAGGGAGTGGAGGG + Intronic
1002614216 5:180440478-180440500 TCAAGGAGGAAGGGGATGGAGGG + Intergenic
1003527741 6:6911934-6911956 TAGATGATGCAGGAAAAGGAGGG - Intergenic
1004173295 6:13315987-13316009 TCTAGGCAGAAGGAAAGGGAAGG - Intronic
1004597241 6:17111811-17111833 TCCAAGATCAAGGCAATGGAAGG + Intronic
1008290533 6:49710192-49710214 TTGAGCATAAAGGCAATGGATGG - Intronic
1008916780 6:56796594-56796616 TCTAGGATGCAGGCAATGGTTGG + Intronic
1009305285 6:62082431-62082453 TTGAAGATGAAGGAAAATGATGG + Intronic
1010756912 6:79676160-79676182 TTTAGGGTGAGGGAAATGGAAGG + Intronic
1011425469 6:87224084-87224106 ACTAGGATTAAGTAAATGGATGG - Intronic
1012059193 6:94455978-94456000 TCCAGAATGAAGGTAATGCAGGG + Intergenic
1017382077 6:153842920-153842942 TTGAGGATGAAAGAAATGGCTGG - Intergenic
1017492817 6:154959042-154959064 CCGGGGGTGCAGGAAATGGAAGG - Intronic
1017622074 6:156309309-156309331 TGGGGGATGGAGGAAATGGAAGG + Intergenic
1018234496 6:161710887-161710909 GGGAGGAGGAAGGAAAGGGAGGG - Intronic
1018444811 6:163846020-163846042 TCCATGCTGTAGGAAATGGAAGG + Intergenic
1021137150 7:16979311-16979333 TGGAAGATGGAGGCAATGGAAGG - Intergenic
1021452721 7:20797899-20797921 GTGAGGAGGAAGGAAAGGGAGGG - Intergenic
1022288148 7:28974990-28975012 TCCAGGATGTAGGGAATGTAGGG + Intergenic
1023237745 7:38108054-38108076 TCTTGGATGAAAAAAATGGATGG - Intergenic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1027004606 7:74682225-74682247 TTGAGAATAAAGGATATGGAAGG + Intronic
1027502139 7:78966328-78966350 TAGAGGGAGAGGGAAATGGAGGG - Intronic
1030844543 7:114392896-114392918 TGGAGGATGAGGTAAGTGGATGG + Intronic
1033141671 7:138832543-138832565 TGGAGGAAGAAGGAAAAGGAAGG + Intronic
1034636927 7:152575057-152575079 TCAAGCAGGAAGGGAATGGAAGG + Intergenic
1035206675 7:157298163-157298185 TAGAAGAAGAAGGAAATGGCTGG + Intergenic
1035558071 8:581204-581226 TCGTAGATGAAGGGAAAGGAGGG - Intergenic
1036295342 8:7530239-7530261 TCCAGGAAGATGGAAAAGGATGG - Intergenic
1036327228 8:7790779-7790801 TCCAGGAAGATGGAAAAGGATGG + Intergenic
1038642916 8:29341756-29341778 TAGAGGATGAGGGAAGAGGAAGG + Intronic
1038866186 8:31441048-31441070 TCAAGGAGGAAGGCAAAGGATGG + Intergenic
1040637525 8:49292374-49292396 ACGAGGGTGAAGAAAATGAATGG - Intergenic
1040692507 8:49956996-49957018 AGGAGGGTGAGGGAAATGGAGGG + Intronic
1040829238 8:51659515-51659537 TTGAGGATGAAGAAAAGGGATGG + Intronic
1041089421 8:54288306-54288328 CCGAGGAACAAGGAAATGGAGGG + Intergenic
1042366141 8:67939097-67939119 TCAGGGATGAGGGAAAGGGAGGG - Intergenic
1044519294 8:93179100-93179122 TCTAGGATGATGGAAGTGGATGG + Intergenic
1044951848 8:97442826-97442848 TTGAGGGTGAAGGAAAAGGCAGG - Intergenic
1045776064 8:105804127-105804149 TTCAGGATTAAGAAAATGGACGG - Exonic
1046041060 8:108905496-108905518 TGGAGGATAAAGCACATGGAAGG + Intergenic
1046457105 8:114480914-114480936 TAGAGAATGCAGGAAAGGGAAGG - Intergenic
1049859751 8:144890370-144890392 CCGAGGATCACGGAAATTGAAGG + Exonic
1050469500 9:5971844-5971866 TTGAGGATGAGGGGAAGGGAAGG - Intronic
1050587718 9:7130430-7130452 TCACAGAGGAAGGAAATGGAGGG - Intergenic
1052181001 9:25527665-25527687 TTGAGGATGAAGGATTTTGAAGG - Intergenic
1053386406 9:37694000-37694022 TCTAGGAGAAAGGAAATGAATGG - Intronic
1054882198 9:70155642-70155664 TGGAGGCTGAAGGAATGGGAGGG - Intronic
1054977924 9:71170247-71170269 ACGAAGATGAAGGGAAGGGAAGG + Intronic
1055748741 9:79480221-79480243 TATAGGATGAAGGAAATGGGTGG + Intergenic
1056733557 9:89185581-89185603 TCTAGGATGAAGGCACGGGAGGG + Intergenic
1059359941 9:113734344-113734366 TCCATGAGGAAGGAAATGGGAGG + Intergenic
1059589885 9:115647366-115647388 AGGAGGAGGCAGGAAATGGAAGG - Intergenic
1060495551 9:124115832-124115854 TTTAGGATGATGGAAAAGGATGG + Intergenic
1061635490 9:131905839-131905861 GGGAGGAAGAAGGAACTGGAAGG - Intronic
1185849412 X:3471212-3471234 TCGAAGATTAAAGAAATGTATGG + Intergenic
1187023325 X:15407132-15407154 TCCTGGGAGAAGGAAATGGAAGG - Intronic
1187300351 X:18043171-18043193 TAGAGGATGCAGGAAATGAAAGG + Intergenic
1188537753 X:31216203-31216225 TCCAGGAGGAAGGATAGGGATGG + Intronic
1188692278 X:33144839-33144861 TCTATGATGAAGGAAATGGTGGG - Intronic
1188946759 X:36314898-36314920 TTGTGGATGACGGATATGGATGG + Intronic
1189367643 X:40401394-40401416 TGGAAGATCAAGGAAATAGAAGG - Intergenic
1193917133 X:87379232-87379254 TCCAGAATGTAGGAATTGGATGG + Intergenic
1195001186 X:100644832-100644854 TCCAGAACGAAGGAACTGGATGG + Intronic
1197674323 X:129313396-129313418 TCGGGGAGGAAAGACATGGAAGG - Intergenic
1202301894 Y:23424855-23424877 TTGAGGATAAAGGAAATGAGAGG + Intergenic
1202568917 Y:26245743-26245765 TTGAGGATAAAGGAAATGAGAGG - Intergenic