ID: 1167134451

View in Genome Browser
Species Human (GRCh38)
Location 19:47608740-47608762
Sequence CCGGGTCCCGCCGCTCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 212}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167134441_1167134451 4 Left 1167134441 19:47608713-47608735 CCGGACGTCCGCAGCCTCCCATT 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212
1167134443_1167134451 -4 Left 1167134443 19:47608721-47608743 CCGCAGCCTCCCATTGGCTCCGG 0: 1
1: 0
2: 3
3: 31
4: 341
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212
1167134435_1167134451 25 Left 1167134435 19:47608692-47608714 CCGGCGCGGAGGGCCCAGTCCCC 0: 1
1: 0
2: 2
3: 15
4: 181
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212
1167134438_1167134451 11 Left 1167134438 19:47608706-47608728 CCAGTCCCCGGACGTCCGCAGCC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212
1167134440_1167134451 5 Left 1167134440 19:47608712-47608734 CCCGGACGTCCGCAGCCTCCCAT 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212
1167134439_1167134451 6 Left 1167134439 19:47608711-47608733 CCCCGGACGTCCGCAGCCTCCCA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212
1167134446_1167134451 -10 Left 1167134446 19:47608727-47608749 CCTCCCATTGGCTCCGGGTCCCG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212
1167134437_1167134451 12 Left 1167134437 19:47608705-47608727 CCCAGTCCCCGGACGTCCGCAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167134451 Original CRISPR CCGGGTCCCGCCGCTCGGCC TGG Intronic
901063774 1:6485528-6485550 CGGGGTCCCCGCGCTCGGCGGGG - Intronic
901084681 1:6603153-6603175 CCCGGTCCCGGCGCGCGGCGAGG - Intronic
901633275 1:10658241-10658263 CGGGGTCCCGACGCAGGGCCTGG - Intronic
902044204 1:13513210-13513232 CCGGCGCCTTCCGCTCGGCCGGG - Exonic
903187045 1:21634636-21634658 CCGGATCCCGGAGCTGGGCCAGG + Intronic
903628228 1:24745980-24746002 CCGGGCCCCGGCGCCCGGGCGGG - Intronic
904044901 1:27603221-27603243 CCGGGGCCCGCGGCTCGGCTGGG - Intronic
915104150 1:153522001-153522023 CCGTGTCTCGCCGCGCGGCAGGG + Intergenic
916963199 1:169909755-169909777 CCCGGTCCCGGTGCACGGCCGGG + Intergenic
919820330 1:201468418-201468440 CCCGGTCCCGAGGCTCTGCCGGG + Exonic
919916946 1:202144665-202144687 CCGGGTCCCGCGGCTCGGTGCGG + Exonic
1063660966 10:8034907-8034929 CCGGGTCCCGAGGCGCCGCCCGG - Intergenic
1065025230 10:21534540-21534562 CCGGCGCCCCCCGCCCGGCCCGG - Intronic
1069544491 10:69318813-69318835 CCGGCTCCTCCCCCTCGGCCCGG - Intronic
1070877289 10:79826082-79826104 CCCGGCCCCGCCGCCCGCCCCGG + Intergenic
1071598243 10:86943199-86943221 CCAGCTGCCGCCGCTCGTCCAGG + Exonic
1071643786 10:87342126-87342148 CCCGGCCCCGCCGCCCGCCCCGG + Intergenic
1072152652 10:92696053-92696075 CCGGGCCCCGCCGCGCGGAGCGG - Intergenic
1073290095 10:102409189-102409211 CCGGGCCGCGCCGCTCGCGCTGG - Intronic
1076116780 10:127906839-127906861 CCTGGTCCAGCCACTCCGCCGGG - Intergenic
1077419853 11:2445053-2445075 CCCGGTGCCGCCGCTCGGGCCGG + Exonic
1077491520 11:2862969-2862991 CCGGGACCCCCTGCCCGGCCCGG + Intergenic
1078246103 11:9574151-9574173 CCGAGCGCCGCCGCTCGCCCGGG + Exonic
1078594444 11:12674559-12674581 CCGGGCCCCGCCGCGCGGAATGG - Intergenic
1079023294 11:16925817-16925839 CCAGGTGCTGCCGTTCGGCCAGG + Intronic
1081938077 11:46918412-46918434 CCGGCTCCCGCCGGACGGCGCGG + Exonic
1081994591 11:47355235-47355257 GCGGGTGGCGCCGCTCGGCCAGG + Exonic
1083667938 11:64285536-64285558 CGGGGTCGTGCCGCCCGGCCGGG - Intronic
1085157733 11:74311644-74311666 GCGGCTGCCGCCGCGCGGCCAGG - Exonic
1092906050 12:13101407-13101429 CCGGGTACCCCCGCCCGACCCGG - Intronic
1093638833 12:21502002-21502024 CTGGGTCTCGCCCCTCCGCCGGG + Intronic
1095094362 12:38137899-38137921 CCGGTTCCCGGCGCACGGCGAGG - Intergenic
1095971526 12:47905045-47905067 CCTGGCCCCGCCTCTCGGTCAGG + Intronic
1095981864 12:47978658-47978680 CCGGGTTCACCAGCTCGGCCAGG + Exonic
1096042294 12:48528295-48528317 CGGGGACCCGCCGCTCATCCTGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096389631 12:51218194-51218216 CCGGGACCTCCCGCTCGGCCAGG - Intergenic
1100385566 12:94102052-94102074 GCGGGTCCCGGCTCTCGGCCTGG - Intergenic
1101592944 12:106139340-106139362 CCGGGGCCGGTCGCTCGGCCTGG + Exonic
1101605785 12:106247246-106247268 CCGGCTCCCGCCTCCGGGCCTGG + Intronic
1102152748 12:110699926-110699948 CAGGGACCCCCCGCTCTGCCAGG + Intronic
1103407757 12:120687542-120687564 CTGGATCCCGCGGCTCGGCAGGG - Intronic
1104847105 12:131852170-131852192 CCAGGTCCCGGTGCTCGGCCGGG - Intergenic
1106735932 13:32587179-32587201 CCGGGTCCCCGCGCGCCGCCTGG + Intronic
1108518176 13:51222263-51222285 GCGGGTCCCGCCGGACGGCGAGG + Intergenic
1112402086 13:99086380-99086402 CCTGCTCCCGCGGCCCGGCCCGG + Intronic
1113657166 13:112074034-112074056 CCGGGAGCCGCAGCTCTGCCCGG - Intergenic
1113874280 13:113584859-113584881 CCCGGTCCGGCCGCGCGGGCGGG - Exonic
1114194953 14:20469215-20469237 CCGGCTCCCCCCGCCCGCCCCGG + Intronic
1114485884 14:23061481-23061503 CCTGCTCCCGCTGCTCTGCCCGG + Exonic
1118627808 14:67674874-67674896 CCGGGCCCCGCCGGCCGGCGAGG + Intronic
1119046328 14:71321144-71321166 CCCGGTGCCGCCGCGCGTCCCGG - Intronic
1119405345 14:74395309-74395331 CCAGGTCCAGCAGCTCTGCCAGG + Intergenic
1121111057 14:91313406-91313428 CCAGGTCCCGCCGCAGCGCCTGG + Exonic
1122151876 14:99730172-99730194 CCGGCGCCGCCCGCTCGGCCTGG - Intergenic
1122582315 14:102778098-102778120 CCGGGCCCCCCCGGCCGGCCCGG - Intronic
1122637832 14:103138586-103138608 CCGGAGCCCGCCCCTCTGCCAGG - Intergenic
1122779252 14:104136713-104136735 CCGCGTCCCGCAGCCCGGGCTGG + Intergenic
1122848457 14:104513562-104513584 CCGGGCCCAGCCACCCGGCCTGG - Intronic
1122940953 14:104981162-104981184 CCTGGTCCTGCCCCTCAGCCTGG + Intergenic
1125516543 15:40324076-40324098 CCGGCTTGCCCCGCTCGGCCGGG - Intergenic
1128583013 15:68821463-68821485 CCGGGTCCGGCGGCTCGCGCTGG + Intronic
1128982536 15:72197793-72197815 CTGGGTCCCGGCGCGCGGTCGGG - Intergenic
1129226598 15:74174043-74174065 CCCGCTCCCGCCGCTGGCCCTGG - Intronic
1129948220 15:79560539-79560561 CCCGGTCCGGCCGCGCGGGCGGG + Intergenic
1132809724 16:1791748-1791770 CCAGCTCCCGGAGCTCGGCCAGG + Exonic
1133038317 16:3046695-3046717 CAGGGTCGCGCCGCTGGGTCGGG - Exonic
1133079302 16:3305748-3305770 CAGGCTCCAGCCGCGCGGCCCGG - Intronic
1133286747 16:4694252-4694274 CCGGGCCCCGCCCCCCGCCCCGG + Intronic
1136401156 16:30019717-30019739 CTGGTTCCCGACGCTGGGCCAGG - Intronic
1136551963 16:30986665-30986687 CCAGGACCAGCCACTCGGCCAGG - Exonic
1137554467 16:49461819-49461841 CCAGGTCCTGCCTGTCGGCCGGG + Intergenic
1138105931 16:54287099-54287121 CCAGGTCCCGCGCCTCAGCCTGG - Intergenic
1139853758 16:69965389-69965411 CCGGGACCCGCCCCTTGTCCGGG + Intergenic
1139882736 16:70188302-70188324 CCGGGACCCGCCCCTTGGCCGGG + Intergenic
1140369774 16:74407217-74407239 CCGGGACCCGCCCCTTGGCCGGG - Intergenic
1141582744 16:85011406-85011428 GCGGGCCCCGCGGCTCGGCTCGG + Exonic
1142764503 17:2057734-2057756 CGGGGGGCCCCCGCTCGGCCTGG + Exonic
1144527179 17:15999983-16000005 CCGAGTCGCGCCGCACGGCCGGG + Exonic
1145265572 17:21378162-21378184 TGGGGTCCAGCCGCGCGGCCAGG - Intronic
1147139604 17:38453818-38453840 CCGGGGCCCGCCGGCCGCCCGGG + Intronic
1148048681 17:44758990-44759012 CCCGGCCCCGCCGCCCCGCCGGG + Intergenic
1148106461 17:45121372-45121394 CCGGGTCCTCCCGCCCCGCCAGG - Exonic
1148206775 17:45784373-45784395 CCCGGCCCCGCGGCCCGGCCCGG - Intronic
1150003173 17:61454663-61454685 GCCGGTCCCGCAGCTCGGACTGG - Intronic
1150983487 17:70169422-70169444 CCGGGGCCGGCCGCGCGGCCAGG + Intronic
1152236171 17:79140024-79140046 CCTGGTCCCGCGGCCCTGCCAGG + Intronic
1152396325 17:80035795-80035817 CCGGGTCCCGCTGCGGGGGCCGG + Exonic
1152628515 17:81399388-81399410 CCCGGCCCCGCCACCCGGCCTGG + Intronic
1155218402 18:23662848-23662870 CGCGCTCCCGCCGCCCGGCCCGG + Exonic
1156411092 18:36828940-36828962 CCGGTTCCCGCGGCCCCGCCCGG + Intronic
1158435866 18:57435455-57435477 CCGGGCCCCGCCGCTCGGGCCGG - Intergenic
1158976566 18:62715933-62715955 CCGGCACCCCCCGCTCTGCCCGG - Exonic
1160731503 19:643537-643559 CCGCGTCCGGCCGCCTGGCCGGG - Exonic
1161354279 19:3810437-3810459 CCGGCTTCCGCCCCTCTGCCTGG + Intronic
1162145556 19:8610829-8610851 CCGCCTGCCGCCGCCCGGCCTGG + Intergenic
1162778672 19:12995688-12995710 CCGCGGCCCCGCGCTCGGCCCGG - Exonic
1163117978 19:15199929-15199951 GCGGGACCCGCGGCTGGGCCGGG - Intronic
1163916858 19:20247606-20247628 CAGGGTCCAGCCGTTCTGCCAGG + Intergenic
1164615653 19:29665525-29665547 CCGCGACCCGCAGCCCGGCCGGG - Intronic
1164834706 19:31349721-31349743 CCGGCCCCCGCCCCTAGGCCGGG + Intergenic
1166389634 19:42401851-42401873 CCCCGTCTCCCCGCTCGGCCCGG + Exonic
1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG + Intronic
1167456107 19:49597318-49597340 CCGGCTCCCGACGCCCGGCCAGG - Exonic
1168293848 19:55369585-55369607 CCCGCTCCCGCGGCCCGGCCGGG - Intronic
926008879 2:9393132-9393154 CCGGGGCCCTCAGCTCTGCCCGG - Intronic
926154820 2:10448050-10448072 CCGGGGCCCGCAGCCCGCCCCGG + Intronic
926423345 2:12718877-12718899 CCGGGTCCCGCTGCCCGGGGGGG + Intronic
932765297 2:74465318-74465340 CCGGCTCCCGCCTCTCGCCCTGG + Exonic
932780239 2:74554706-74554728 CCGCCTCCCGCCGCAGGGCCAGG + Exonic
933728038 2:85437567-85437589 CCCTGTCCCGCAGCTCCGCCTGG - Intergenic
938018295 2:127885694-127885716 CCCGGCCCCGCCGCCCGCCCCGG + Intronic
942653744 2:178194382-178194404 CCGGCTCCCGCCCGTCCGCCCGG - Intergenic
942965881 2:181891961-181891983 CCGGGGCCCCCTGCCCGGCCGGG + Exonic
946404060 2:219483526-219483548 CCAGCTCCCGCGGCCCGGCCCGG - Exonic
946407153 2:219497869-219497891 CCGGGACCTGCGGCACGGCCAGG + Intronic
948592845 2:239062408-239062430 CTGGGCCCCGCCCCTCTGCCCGG - Intronic
1168757186 20:325807-325829 CCCCGCCCCGCGGCTCGGCCCGG - Exonic
1168802602 20:653099-653121 CTGCGCGCCGCCGCTCGGCCCGG + Exonic
1172118430 20:32584522-32584544 GCGGGTCCCGCCGCGGGGCTTGG - Intronic
1172703033 20:36863990-36864012 CCGGCTCCCGCCGCTCTCGCAGG - Intergenic
1174804162 20:53592649-53592671 CCGGGTCTTGCCCCTCGGGCGGG + Intronic
1175344737 20:58264739-58264761 CCGGGTCCTGTCGCTGTGCCCGG - Intergenic
1176380522 21:6110418-6110440 CCGGGACCGGCCGCGCGGCGGGG + Intergenic
1176548058 21:8209888-8209910 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1176550443 21:8218711-8218733 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1176555951 21:8254098-8254120 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1176566989 21:8392923-8392945 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1176569372 21:8401750-8401772 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1176574888 21:8437133-8437155 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1176577285 21:8445981-8446003 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1176611503 21:8988429-8988451 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1179742950 21:43427822-43427844 CCGGGACCGGCCGCGCGGCGGGG - Intergenic
1180908347 22:19431513-19431535 CCGGGTCCCTCAGCGCGCCCGGG + Exonic
1180960050 22:19758496-19758518 CCGAGGCCCGCCGCTCTGCCTGG - Intronic
1181094319 22:20495515-20495537 CCGGGATCTGGCGCTCGGCCAGG - Intronic
1181272251 22:21665988-21666010 CCGGGTTCCGCGGCGCGCCCCGG - Exonic
1181851471 22:25752900-25752922 CCGGCTCGCGCCGCTAGCCCCGG + Intronic
1182664003 22:31944425-31944447 CCGCTCCCCGCCGCCCGGCCTGG + Intronic
1184035229 22:41914919-41914941 CGAGGACCCGCCGCCCGGCCCGG - Intergenic
1184232156 22:43163959-43163981 GCGGCTCCCTCCCCTCGGCCAGG + Intergenic
1184729335 22:46364361-46364383 CCGGGTCCCAGGGCTAGGCCAGG + Intronic
1185272380 22:49935318-49935340 CCGCGCCCCGCCGCCCGCCCGGG - Intergenic
1203252937 22_KI270733v1_random:126188-126210 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1203255339 22_KI270733v1_random:135050-135072 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1203260992 22_KI270733v1_random:171269-171291 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
950282367 3:11719379-11719401 CCGGGTCCCGCCCCGCCGACCGG + Intronic
950433907 3:12967473-12967495 CTGGGTCCCGGCTCCCGGCCCGG - Exonic
953485058 3:43286878-43286900 CCGGACCCCGCGGCGCGGCCTGG + Intronic
953932037 3:47010245-47010267 CCGGCTCCCTCCGCTCAGCAAGG - Intergenic
954803205 3:53199326-53199348 CCGGGTCCCCACCCTCGGCTGGG - Intergenic
955356704 3:58237876-58237898 CTGGGTCCCGCCGCCGGGCCCGG - Exonic
960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG + Intronic
961322306 3:126084197-126084219 CGAGGTCCGGCCGCCCGGCCGGG - Exonic
963038495 3:141051847-141051869 CCGGCTCTCTCCGCACGGCCAGG - Exonic
967055378 3:185825189-185825211 CCGCGCGCCGCCGCCCGGCCCGG - Intergenic
967859619 3:194141328-194141350 CCGGGGCCCTCCGCCCGGGCGGG + Intergenic
969240238 4:5892600-5892622 CCGCGACCTGCCCCTCGGCCGGG - Exonic
969288307 4:6222086-6222108 CCGGCGCCCGCCGCTGCGCCCGG - Intergenic
969778925 4:9381128-9381150 CCGGGTGCCCCCGCTGGGCCCGG - Intergenic
970333182 4:15004352-15004374 CCCGGTCCCGCGGCGCGGCCAGG - Intronic
985896403 5:2751956-2751978 CCGGGGCACGCAGCGCGGCCGGG - Intergenic
990699608 5:58460532-58460554 CCGGAGCCCGCCGCACGGGCAGG + Intergenic
992828154 5:80569742-80569764 CCGGTTCCCGCCGCTCGGCGAGG + Intronic
993905727 5:93621274-93621296 CCGCGCCCCGCCCCTCAGCCAGG + Intronic
1001732287 5:173969295-173969317 CGGGCTGCCGCCGCTCTGCCTGG + Intergenic
1003604003 6:7542735-7542757 CCGGGTCTCGAAGTTCGGCCGGG + Intronic
1003661206 6:8064170-8064192 CCGGGACCCGGGGGTCGGCCCGG + Intronic
1004044280 6:12011306-12011328 CCCGGCCCCGCCCCTCGCCCGGG - Intronic
1004216741 6:13711168-13711190 CCGGGGCCCGCTGCAAGGCCCGG + Exonic
1005670840 6:28104885-28104907 CCGAGTCCCCCAGCTCAGCCAGG + Intergenic
1006337443 6:33428004-33428026 CCGGCTCGCGCCGCCCGGCGCGG - Intronic
1006351092 6:33521701-33521723 CCGGGTCCCCCAGCACTGCCGGG - Intergenic
1006378519 6:33684757-33684779 CCGAGTCCCGCCTCCAGGCCTGG + Exonic
1011734277 6:90296436-90296458 CCGGGCCCCGCCGCTGGGCGGGG - Intronic
1013556230 6:111259651-111259673 CCCGGTCCCACCGCTCTGCCAGG - Exonic
1015440345 6:133240987-133241009 GCGGGTCCCTCCCCTCAGCCTGG + Intronic
1015935686 6:138404361-138404383 CCCGGTCCCTCCTCCCGGCCGGG - Exonic
1018013428 6:159692631-159692653 CTGCCTCCCGCCGCTCAGCCTGG + Intronic
1018727976 6:166627905-166627927 GCGGGCCCTGCAGCTCGGCCAGG + Intronic
1019417715 7:934978-935000 CTGGGTCGTGCCGCGCGGCCTGG + Intronic
1019475494 7:1242298-1242320 CCGGCACCTGCCGCTCCGCCCGG + Intergenic
1019475524 7:1242379-1242401 CCGGGCCCAGCGTCTCGGCCGGG - Intergenic
1020011818 7:4809366-4809388 CCGCCTCCCCCCGCTCAGCCGGG - Intronic
1020037679 7:4974486-4974508 CCGCCTCCCGCCGCTCCTCCAGG - Intergenic
1020162139 7:5781138-5781160 CCGCCTCCCGCCGCTCCTCCAGG + Intronic
1022111540 7:27235444-27235466 TCGGATCCCGCGGCTCTGCCCGG - Intergenic
1024684878 7:51734328-51734350 CAGGGTGCAGCCCCTCGGCCTGG + Intergenic
1026010036 7:66629212-66629234 CCGCGGCCCGCCGCCCGCCCGGG - Intronic
1029444780 7:100605808-100605830 CCAGGTCCCGCCCCTCACCCCGG - Exonic
1033214435 7:139483387-139483409 GCGCGTGCCGCCGCTCAGCCTGG - Exonic
1034418718 7:150978164-150978186 GCGGGCCCCGCGGCTCGGCGGGG - Exonic
1036344973 8:7955257-7955279 CCGGATGCCCCCGCTGGGCCCGG + Intergenic
1039881703 8:41629233-41629255 CCGGTTCCTGCTGCTCGGCGTGG + Intergenic
1045259399 8:100559342-100559364 GCAGGTCCAGCTGCTCGGCCGGG - Intronic
1047998472 8:130358246-130358268 CCGCCACCCGCCGCCCGGCCTGG + Intronic
1049329720 8:142043741-142043763 CCGGCTCCCGGGGCTTGGCCTGG - Intergenic
1053160690 9:35811447-35811469 CCTGGTCCTGCCTCTGGGCCTGG - Exonic
1055466512 9:76571805-76571827 CCCGGTCCCGGCGCACGGCGGGG - Intergenic
1059268857 9:113060277-113060299 CCGGGGCCCGAAGCTCGCCCAGG + Intergenic
1059269993 9:113065726-113065748 CCGGGGCCCGAAGCTCGCCCAGG + Intergenic
1059271127 9:113071174-113071196 CCGGGGCCCGAAGCTCGCCCAGG + Intergenic
1059272260 9:113076620-113076642 CCGGGGCCCGAAGCTCGCCCAGG + Intergenic
1059273395 9:113082062-113082084 CCGGGGCCCGAAGCTCGCCCAGG + Intergenic
1059274531 9:113087508-113087530 CCGGGGCCCGAAGCTCGCCCAGG + Intergenic
1060106470 9:120876422-120876444 CCGGGGGCCCCCGCCCGGCCAGG - Intronic
1060479975 9:124012184-124012206 CCGGGGCCCGGAGCCCGGCCTGG + Exonic
1061108971 9:128553099-128553121 CCCGGTCCCTTCCCTCGGCCGGG + Intronic
1061680739 9:132241395-132241417 CTTGGACCCGCCCCTCGGCCCGG - Intronic
1062248718 9:135583719-135583741 CCGGGTCCCTCCTCTCATCCCGG - Intergenic
1062364625 9:136202915-136202937 CCCGGTGCAGCCACTCGGCCCGG + Intronic
1062504637 9:136866609-136866631 CCGGGCCCCGCACCCCGGCCGGG + Intronic
1062595103 9:137295851-137295873 CCGGGTGCGCCCCCTCGGCCCGG + Intergenic
1203469339 Un_GL000220v1:109335-109357 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1203471737 Un_GL000220v1:118187-118209 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1203477160 Un_GL000220v1:153307-153329 CCGGCGCCCGCCCCCCGGCCGGG - Intergenic
1192237533 X:69305589-69305611 CCGGGTCACGCAGCTGAGCCCGG + Intergenic
1196442428 X:115728716-115728738 CAGGGTCCCGCAGGTGGGCCAGG - Intergenic
1196443129 X:115732188-115732210 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196445450 X:115844103-115844125 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196446121 X:115847084-115847106 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196446792 X:115850065-115850087 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196447460 X:115853048-115853070 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196448131 X:115856027-115856049 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196448800 X:115859018-115859040 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196449471 X:115862009-115862031 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196450140 X:115864992-115865014 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196450810 X:115867977-115867999 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196451481 X:115870956-115870978 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196452152 X:115873943-115873965 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196452822 X:115876912-115876934 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196453492 X:115879905-115879927 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196454161 X:115882914-115882936 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196454828 X:115885903-115885925 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196455242 X:115887985-115888007 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1198806697 X:140501550-140501572 CCTGGTCCTGCCGCGCGTCCAGG - Intergenic
1200141654 X:153905599-153905621 CCGGGACCCGCTGCTAGCCCGGG + Exonic
1200239504 X:154486421-154486443 CCGGCTCCCGGCCCTCGGCCCGG + Intronic