ID: 1167134955

View in Genome Browser
Species Human (GRCh38)
Location 19:47610271-47610293
Sequence TCCCCGCGGCCGCCCGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 79}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167134955_1167134968 24 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134968 19:47610318-47610340 GCCTTGGTGCGCGGCCAGCCGGG 0: 1
1: 0
2: 0
3: 12
4: 132
1167134955_1167134960 -8 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134960 19:47610286-47610308 CGCGGGGAGACGAGGGACCAGGG 0: 1
1: 0
2: 0
3: 10
4: 135
1167134955_1167134966 15 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134966 19:47610309-47610331 GCTGCTTGGGCCTTGGTGCGCGG 0: 1
1: 0
2: 0
3: 13
4: 135
1167134955_1167134964 8 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134964 19:47610302-47610324 ACCAGGGGCTGCTTGGGCCTTGG 0: 1
1: 0
2: 3
3: 56
4: 516
1167134955_1167134970 27 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134970 19:47610321-47610343 TTGGTGCGCGGCCAGCCGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 67
1167134955_1167134967 23 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134967 19:47610317-47610339 GGCCTTGGTGCGCGGCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 117
1167134955_1167134961 -7 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134961 19:47610287-47610309 GCGGGGAGACGAGGGACCAGGGG 0: 1
1: 0
2: 0
3: 25
4: 261
1167134955_1167134962 1 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134962 19:47610295-47610317 ACGAGGGACCAGGGGCTGCTTGG 0: 1
1: 0
2: 4
3: 18
4: 191
1167134955_1167134963 2 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134963 19:47610296-47610318 CGAGGGACCAGGGGCTGCTTGGG 0: 1
1: 0
2: 2
3: 14
4: 198
1167134955_1167134959 -9 Left 1167134955 19:47610271-47610293 CCTGTCACGGGCGGCCGCGGGGA 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1167134959 19:47610285-47610307 CCGCGGGGAGACGAGGGACCAGG 0: 1
1: 0
2: 0
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167134955 Original CRISPR TCCCCGCGGCCGCCCGTGAC AGG (reversed) Intronic
901022241 1:6261254-6261276 TCCCCGCGTCCGCCCGCGGCCGG + Intergenic
901084664 1:6603096-6603118 TCCCCGCTGACGCCCGGGCCGGG + Intronic
901443475 1:9293141-9293163 TCCCCGCGTCCGCCCTCGCCCGG - Intronic
901506781 1:9689999-9690021 TCTCCGCTGCCGCCCTTGATGGG + Intronic
903142115 1:21345147-21345169 TCGGCGCGGCCGCCCCCGACGGG + Intronic
903349877 1:22711088-22711110 CGCCGGCGGCCGCCCGTGCCCGG - Intronic
903349903 1:22711156-22711178 TCCCCGCGGCCACCTGCGCCCGG - Intronic
905793445 1:40802400-40802422 TCCCCGCGGCCTCCCCCGCCCGG - Intronic
907501951 1:54887375-54887397 TCCCCGCCGCCGCGCGAGGCGGG + Intergenic
910936244 1:92485958-92485980 TCCCCGCGGCCGCCCCCACCAGG + Intronic
911188558 1:94926810-94926832 CCCCCGCGCCCGCCCGAGCCAGG + Intronic
920379797 1:205528893-205528915 TCCCTGCAGCCGCCTGTGGCAGG + Intronic
923716420 1:236428608-236428630 TCCGCCCGGCCGCCCATGTCTGG - Intronic
1075900891 10:126042055-126042077 TCCCCAAGGCCTCCTGTGACTGG - Intronic
1076939189 10:133590458-133590480 TCCCGGTGGCCGCCCCTGCCTGG + Intergenic
1077104233 11:835039-835061 TTCCCGGGGCCGCACGTCACAGG - Intronic
1078699753 11:13669004-13669026 GCCCCGCCGCCGCCCTTCACAGG + Intronic
1080012324 11:27471998-27472020 GCCCCGCCGCCGCCCGGGCCTGG - Intronic
1081831508 11:46119971-46119993 GCCCCGCGGCCGCCGGCGGCGGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084656526 11:70522909-70522931 TGCCCGCGGCCGCACGTTGCCGG - Intronic
1085396890 11:76210876-76210898 TCCCCGCGGACGCCACTGACCGG + Intergenic
1090442846 11:126738361-126738383 TTCCAGCTGCAGCCCGTGACTGG - Intronic
1092843284 12:12562766-12562788 ATCCCGCGGCCGCCCGAGCCCGG + Intergenic
1102646152 12:114405312-114405334 TCCCCGCGGCCGGCAGTGAATGG - Intronic
1116003268 14:39266893-39266915 CCACCGCGGCCGCCCGAGGCGGG + Intronic
1117699233 14:58396438-58396460 TTCCCTCAGCCGCCCGTGCCCGG + Intronic
1121491278 14:94363228-94363250 TCCCCGCCGTCGCCTCTGACGGG + Intergenic
1122719954 14:103716225-103716247 TCCCGGCGCCCGCCCTGGACAGG - Intronic
1132879518 16:2155835-2155857 CGCCCGCGGCCGCCCGGGAGCGG - Exonic
1139544683 16:67644815-67644837 TCCCCGCGGCCCACCGGGGCTGG - Intergenic
1142876076 17:2852978-2853000 TCCCCGCGCCCACCCGGGCCTGG - Intronic
1144564895 17:16352418-16352440 TCCCCGCCGCCGCGCGAGGCCGG + Intronic
1145041308 17:19579973-19579995 TCCCCGCCGCCGCCAAGGACCGG + Intergenic
1146916770 17:36682933-36682955 TCCCCGCTGCCCCCAGTGTCAGG + Intergenic
1147436193 17:40417698-40417720 TCTCTCTGGCCGCCCGTGACGGG - Intronic
1148936326 17:51166717-51166739 TCCCCGCGGCCGCGCGTGGTGGG + Exonic
1149772402 17:59331976-59331998 TCCCCGTGGGCGCCGGGGACGGG + Intronic
1150108562 17:62479020-62479042 CCCCCGCGGCCGCCCGGGCCCGG + Exonic
1150488191 17:65558538-65558560 GCCCCGCGGCCCCCAGTGCCAGG - Exonic
1151728219 17:75896629-75896651 CTCCAGCGGCCGCCCGTGGCGGG + Exonic
1152870832 17:82752212-82752234 TCCTCGGGGCCGCCCGCGGCCGG - Exonic
1157222755 18:45839107-45839129 CCCTCGCGGCCACCCGTGTCTGG - Intronic
1160540162 18:79616917-79616939 TCCCCGCGTCCGGCCGTAGCTGG + Intergenic
1161703106 19:5805409-5805431 GCCGCGCGGCCGCCACTGACGGG + Intergenic
1163346317 19:16744711-16744733 TCCCTGCGGCCTCACCTGACCGG - Exonic
1165213656 19:34254511-34254533 TCCCCGCGTCCGCCCGAGGCGGG + Intergenic
1167071770 19:47226276-47226298 TCCCCGCGGCCGCGGGCCACGGG + Intronic
1167134955 19:47610271-47610293 TCCCCGCGGCCGCCCGTGACAGG - Intronic
926268165 2:11344618-11344640 CCCGCGCGGCCGCCCGTCTCCGG + Intronic
931710975 2:64989089-64989111 TCCCCGCGGTCGCCCGGAGCCGG + Intronic
941020849 2:160407269-160407291 TCGCCGCCGCCGCCCGGGCCGGG - Intronic
941773207 2:169364403-169364425 TCGCCTCGGCCGCCCGGAACCGG - Intergenic
942454859 2:176130589-176130611 TCCCCGCCGCCCTCCGGGACTGG + Exonic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
1170756889 20:19212778-19212800 CCGCCGCGGCCGCCCGCGACAGG + Exonic
1172117974 20:32583310-32583332 CCTCCGCGGCCGCCCGGGCCGGG - Intronic
1181057734 22:20267966-20267988 TCGCCTCGGCAGCCCGGGACGGG + Intronic
1185199144 22:49491351-49491373 TCCTCTCTGCCGCCCGGGACTGG + Intronic
1185321289 22:50201250-50201272 TCCGCGCCGCGGCCCGTGCCCGG + Exonic
955770036 3:62377090-62377112 GCCCGGCGGCCGTGCGTGACGGG - Intergenic
967924185 3:194633378-194633400 TCGCCGCCGCCGCCCGCGCCCGG - Exonic
968674958 4:1872003-1872025 CCACCGCGGCCGCCCCGGACCGG - Intronic
974315909 4:60281080-60281102 CCACCGCGCCCGGCCGTGACAGG - Intergenic
976897319 4:90127895-90127917 TCCCCGCGTCCGCCTGCGGCCGG - Intronic
986608250 5:9544797-9544819 TCCCCGCGGCGGCCGGTGCCTGG - Intronic
996862780 5:128084133-128084155 GCCCCGCGGCGGCCGGGGACGGG + Exonic
997479824 5:134176751-134176773 TGCCCGCGGCGGGCGGTGACTGG - Intronic
1003074615 6:2971935-2971957 GCCCCGCGCCCGCCCCTGGCTGG - Intronic
1016949451 6:149566261-149566283 TCTCCGCGGCCGCCCGGGGAGGG + Intergenic
1018375016 6:163202129-163202151 TCCCAGCAGCCGGCCGGGACAGG - Intronic
1019529365 7:1495861-1495883 TCCCCACTCCCGCCCGTGGCTGG + Intronic
1020002667 7:4764637-4764659 TCACAGAGGCCCCCCGTGACGGG - Exonic
1024981529 7:55161320-55161342 TCCCAGAGGCCGACCGTGACTGG - Intronic
1031998724 7:128250409-128250431 TCCCAGCAGCTGCCCTTGACTGG + Intronic
1032842959 7:135728347-135728369 TCCCCGCGGCCGCTCTTGATTGG + Intronic
1034508877 7:151519063-151519085 TCGCCGCGGGCGCGCGTGACCGG - Intronic
1037912132 8:22749745-22749767 TCCACACTGCTGCCCGTGACTGG - Intronic
1045047688 8:98294461-98294483 TCCCCGCGGCCGTCCGCAACGGG + Intergenic
1049396461 8:142403238-142403260 TCCCCGCGCGCGTCCGGGACCGG - Intronic
1054906923 9:70420321-70420343 TCCCCGCGGCCGCGCCCGCCCGG + Intergenic
1056560619 9:87726337-87726359 ACCCCGCGGAGGCGCGTGACTGG + Exonic
1057315817 9:93967607-93967629 TCCCCCCGGCCAGCCGTGCCTGG + Intergenic
1059234494 9:112750684-112750706 GCGCCGCGGCCGCCCGGGAGGGG - Intergenic
1059414717 9:114155757-114155779 GCCCCGCGGGCGCCCGCGCCAGG - Exonic
1061002399 9:127909913-127909935 TCCCCGCGTCCCCGCGTGCCCGG + Intronic
1061268468 9:129522536-129522558 TCCCCTCGGCCGCCTCTGATCGG + Intergenic
1061961810 9:133992476-133992498 GCCCCGCGGCCGCACGTGGGCGG - Intronic
1185469359 X:373496-373518 GCCCCGCGGCTGCCCGACACCGG - Intronic
1189396010 X:40623474-40623496 TACCCGCAGCCGACCCTGACTGG - Intergenic
1190326467 X:49209897-49209919 TCCCCGCGCCAGCCCCTGAATGG - Intronic
1190988623 X:55522804-55522826 TCCCAGCAGCCTCCCGTCACAGG + Intergenic
1196842545 X:119871811-119871833 GCCCCGCGGCCGCCCGCGAGCGG - Exonic