ID: 1167141407

View in Genome Browser
Species Human (GRCh38)
Location 19:47653386-47653408
Sequence TGAATTGGTACACTTTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167141407 Original CRISPR TGAATTGGTACACTTTAGAT GGG (reversed) Intronic
900240060 1:1612283-1612305 TGGTTTTGTACACTTTAGAAAGG + Intergenic
901266289 1:7913338-7913360 TGAAGCGGGACACTTAAGATAGG + Intergenic
902911964 1:19605293-19605315 TAAAATTGTACACTTTAAATAGG - Intronic
906351023 1:45059633-45059655 TGAATTTTAACACTTTAAATGGG + Intronic
910280836 1:85499689-85499711 TGAATTGTTACCATTTAGAGAGG + Intronic
911640636 1:100284967-100284989 TAAATTAGTACATTTTAAATAGG + Intronic
913420598 1:118663759-118663781 TGACTTAGAACACTTTAGACAGG + Intergenic
916979867 1:170122918-170122940 TTGAATGGTACACTTAAGATTGG - Intergenic
919027662 1:192198573-192198595 TAAAATTGTACATTTTAGATAGG + Intergenic
922036835 1:221856958-221856980 TGCCTTAGGACACTTTAGATGGG - Intergenic
922547420 1:226468509-226468531 TCAAATTGTACACTTTAAATGGG + Intergenic
923839731 1:237656088-237656110 TGAATTGGTATCCTTTTAATAGG + Intronic
924485256 1:244476745-244476767 TGAATTGGTATACTTCAGGAGGG + Intronic
1063069257 10:2643555-2643577 AGAATAGGTAAACTTTACATTGG - Intergenic
1065982705 10:30917023-30917045 TGGAATGGTACACTTAAGATTGG - Intronic
1066500386 10:35987852-35987874 TGAATCGGAACACTTTTAATAGG - Intergenic
1071447659 10:85763848-85763870 TGAATTGGTACCTTTTGGAAAGG - Intronic
1072210576 10:93242957-93242979 TTAAATTGTACACTTTAAATGGG + Intergenic
1073459182 10:103656305-103656327 TGGATTGGCAAACGTTAGATCGG - Intronic
1073595127 10:104791948-104791970 TTAATTGGGAATCTTTAGATAGG + Intronic
1074288082 10:112117258-112117280 TAAAATTGTACACTTTAAATGGG - Intergenic
1074543022 10:114381509-114381531 TCAAATTGTACACTTTAAATGGG + Intronic
1075289650 10:121217460-121217482 TGAATTGGGACAGTCTAGAAAGG + Intergenic
1078717311 11:13852427-13852449 TGAACTTGACCACTTTAGATTGG - Intergenic
1080155373 11:29104817-29104839 TGAATTCTTAATCTTTAGATTGG + Intergenic
1081094083 11:38910039-38910061 TATATTGCTATACTTTAGATTGG + Intergenic
1081317955 11:41653728-41653750 TATATTGGTACACTTTTTATAGG + Intergenic
1082668960 11:56010276-56010298 TGAATTAGTCCACTGTTGATGGG - Intergenic
1083192533 11:61062631-61062653 TGGGTTGGTTCTCTTTAGATGGG + Intergenic
1084728688 11:71059447-71059469 TGGAGCTGTACACTTTAGATGGG + Intronic
1085010131 11:73134003-73134025 TTGAATGGTACACTTTAAATGGG + Intronic
1085491502 11:76923208-76923230 TTAATTTGTACACTTTAAATAGG - Intronic
1086985043 11:93238328-93238350 TGAAGTGGTTCACTTTAGGATGG - Intergenic
1090708324 11:129360960-129360982 TGAATTTGTACACCTTCAATGGG - Intergenic
1091578269 12:1760357-1760379 TTAAATTGTACACTTTAAATGGG - Intronic
1093416957 12:18930825-18930847 GGAAATGGTACACTCCAGATTGG + Intergenic
1094664687 12:32507341-32507363 TGGGTTGGCAAACTTTAGATTGG + Intronic
1095956680 12:47810582-47810604 TTAAATGGTACACTTTAAAATGG - Intronic
1096054322 12:48638385-48638407 TCAAGTTGTACACTTTAAATAGG + Intergenic
1098117911 12:67200018-67200040 TGAATTGTTAAACTTTGGAAGGG - Intergenic
1099221478 12:79919916-79919938 TTTATTTGTACACTTTAAATGGG - Intronic
1100903486 12:99270582-99270604 TGAATTAGGACACTGTGGATAGG - Intronic
1103464831 12:121133599-121133621 TTAAATGGTACCCTTTAAATGGG - Intronic
1103711899 12:122918764-122918786 TGCATTTGTACACTTTAAAATGG - Intergenic
1104122834 12:125815652-125815674 TGAATTTGGTCACTTTACATGGG + Intergenic
1104260038 12:127173787-127173809 TTAATTTGTATACTTTAAATAGG + Intergenic
1107819889 13:44277057-44277079 TCAAATTGTACACTTTAAATGGG + Intergenic
1108923760 13:55711121-55711143 TGAATTGGTAAATTTCAGAGAGG + Intergenic
1108939553 13:55935774-55935796 TGAATTGGTACAACTTTAATGGG - Intergenic
1109008517 13:56909802-56909824 TGGATTGCCACACTGTAGATGGG + Intergenic
1109890341 13:68603391-68603413 TCAATTTGAACACTGTAGATGGG + Intergenic
1110997796 13:82135771-82135793 TTAAATTGTACACTTTAAATAGG + Intergenic
1111007978 13:82275033-82275055 TGAATTGGTCAATTATAGATTGG + Intergenic
1112544842 13:100357157-100357179 TTAACTTGTACACTTCAGATGGG + Intronic
1112812592 13:103235467-103235489 TGAATTGGTAGACTGTGGGTGGG + Intergenic
1114379812 14:22190521-22190543 AGAATTCGTACACTTTATACTGG + Intergenic
1114790630 14:25654357-25654379 TAAATTGGTAAAATTTATATAGG + Intergenic
1119947891 14:78714160-78714182 TGCACTGGTACTCTCTAGATTGG - Intronic
1124248533 15:28092634-28092656 TGAATTTGTACACTTTAAATGGG + Intronic
1125196358 15:37051576-37051598 TTAAATTGTACACTTTAAATGGG + Intronic
1127093549 15:55490376-55490398 TTAAATTGTACACTTTAAATGGG + Intronic
1128139501 15:65288535-65288557 TTAAATTGTACACTTTAAATGGG - Intronic
1129637445 15:77335834-77335856 TGAATTGGTAAAATGGAGATTGG - Intronic
1129806400 15:78463558-78463580 TGAATTGCTTCAGTTTAGAAAGG - Intronic
1133093448 16:3424066-3424088 TTAATTGGTACAATATAAATAGG - Intronic
1133648142 16:7783714-7783736 TGAATTTGTTCACTTTAAAATGG + Intergenic
1137428987 16:48403060-48403082 TGAAAGTGTACTCTTTAGATTGG - Intronic
1137868328 16:51924764-51924786 TAATTTTGTACACTTTAAATTGG - Intergenic
1138223444 16:55272532-55272554 TGAATTGGTATACTTTTTTTAGG + Intergenic
1139242132 16:65403915-65403937 TGAATTGGTACACTCCAGGATGG - Intergenic
1141251826 16:82365982-82366004 TGAAAAGGTACACTTAAAATAGG - Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1153001807 18:462637-462659 TGAACTGGTACACCTTAAATGGG + Intronic
1153562916 18:6389556-6389578 TGAATTCTTACATGTTAGATGGG - Intronic
1156208558 18:34912776-34912798 AGAATAGTTACACTTCAGATGGG + Intergenic
1159494054 18:69177652-69177674 TTGAATTGTACACTTTAGATGGG - Intergenic
1159758213 18:72391978-72392000 ACAATTGCTACACTTTAGAAAGG + Intergenic
1160369046 18:78356100-78356122 TTAAATTGTACACTTTAAATTGG + Intergenic
1160595927 18:79974240-79974262 TAAATTAGTACAAATTAGATGGG - Intronic
1162436338 19:10661904-10661926 TGAAATGATACACTTGAGCTAGG - Intronic
1162614956 19:11791877-11791899 TGAGTTGTTTCACTTAAGATTGG + Intergenic
1163449973 19:17371084-17371106 TCAAATTGTACACTTTAAATAGG + Intronic
1167141407 19:47653386-47653408 TGAATTGGTACACTTTAGATGGG - Intronic
926892936 2:17653764-17653786 TTAATTTGTACACTTAACATGGG - Intronic
927808412 2:26168429-26168451 CTAAATGGTAAACTTTAGATGGG + Intergenic
927946839 2:27139806-27139828 TCGAATGGTACACTTTAAATGGG - Intergenic
928360368 2:30657580-30657602 TGAATTGGAACTCTTTGGAGAGG - Intergenic
928500759 2:31892440-31892462 TGAATTGGTGCTCTTCTGATGGG - Intronic
932378406 2:71259278-71259300 TCAATTAGTACATTTTGGATGGG - Intergenic
932797658 2:74711487-74711509 TCAAATCGTACACTTTAAATGGG + Intergenic
935475006 2:103508477-103508499 TCAACTTGTACACTTTAAATAGG - Intergenic
937940468 2:127281344-127281366 TGAATTGGTAAAGTTTGGAGAGG - Intronic
940982781 2:160022017-160022039 TCAATTGTTACATTTTAGTTTGG - Intronic
942544656 2:177050719-177050741 TGAATTAGTTCAATCTAGATTGG + Intergenic
942761485 2:179403716-179403738 TGAAGTGGTTCAATTTAGAAAGG - Intergenic
944136663 2:196406861-196406883 TGATTGGGCAGACTTTAGATTGG - Intronic
944505162 2:200403566-200403588 TGAATTGGAACACTAGAGAAAGG - Intronic
945215389 2:207428238-207428260 TGGAATTGTACACTTTAAATAGG + Intergenic
945960637 2:216131033-216131055 TGAAATGGTATGCTTTTGATTGG + Intronic
946996988 2:225404585-225404607 TGATTTGGTGCAATTTAGCTGGG + Intronic
947277607 2:228411196-228411218 TGAAATGGTACAGTTTAAAAGGG + Intergenic
1168785862 20:539759-539781 TGAAATGATAAGCTTTAGATGGG - Intronic
1170943183 20:20866154-20866176 TAAATTAGTACAGTTTAAATAGG + Intergenic
1174055263 20:47794284-47794306 TTCAATGGTACACTTAAGATGGG - Intergenic
1174325988 20:49779316-49779338 TGAAATCATACACTTTAAATAGG + Intergenic
1176089039 20:63310906-63310928 TGGAGTTGTACACTTTAAATGGG - Intronic
1177590871 21:23165097-23165119 TGAAACGTTACACTTTGGATAGG + Intergenic
1178542293 21:33463596-33463618 TCAAATTGTACACTTTAAATTGG + Intronic
1178912504 21:36686997-36687019 TTAAATTGTACACTTTAAATGGG + Intergenic
1185180115 22:49355056-49355078 TTAATTGGTACATTCCAGATGGG + Intergenic
953264009 3:41368396-41368418 TGAGTTTGTACACTTTAAAATGG - Intronic
958176907 3:90007567-90007589 TCAATTTGTACACTTAAAATTGG + Intergenic
958859843 3:99433369-99433391 TGAATTGGTTTACTTTTTATCGG - Intergenic
960402521 3:117219337-117219359 TGAAGTTGGACATTTTAGATAGG - Intergenic
960985069 3:123273496-123273518 TGAAGTGGTTCAATTTAGAAAGG + Exonic
961560913 3:127729513-127729535 TAAATCGGTACACTTTAAAATGG - Intronic
961870295 3:129982747-129982769 TTGAATTGTACACTTTAGATGGG - Intergenic
962083899 3:132170350-132170372 TGAATGGAAAGACTTTAGATGGG + Intronic
970310207 4:14774929-14774951 TGAGTTATTTCACTTTAGATAGG - Intergenic
970760021 4:19473761-19473783 TGACTTGGCAAATTTTAGATAGG + Intergenic
971386209 4:26142481-26142503 GGAAATGGTACACTCTAGTTGGG + Intergenic
973948135 4:55981760-55981782 TGAAATGGTATACTTTAAGTGGG - Intronic
974402553 4:61425296-61425318 TGAAATGGTAAACTTTGGATAGG - Intronic
974854572 4:67444744-67444766 GGAATTGGTTCATTTTATATAGG - Intergenic
974929484 4:68345711-68345733 TGTCTTGGTTCACTTTAGTTTGG - Intronic
976825809 4:89259110-89259132 TCAAGTGGTAGTCTTTAGATTGG - Intronic
978200671 4:106020644-106020666 TGAATTGATACCCTTAAGATAGG + Intergenic
978961619 4:114686489-114686511 TGAAGTGGGAGAATTTAGATTGG + Intergenic
981046975 4:140273843-140273865 TAAACTGTTACACTTTTGATTGG - Intronic
981792177 4:148550814-148550836 TCAACTGGTACACTTTAAATGGG - Intergenic
982236548 4:153256077-153256099 TTAAATTGTACACTTTAAATGGG + Intronic
982488312 4:155996589-155996611 TGTTTTGGGACAATTTAGATGGG - Intergenic
982952108 4:161712229-161712251 TGAATTCGTACACTTCATATGGG + Intronic
984280565 4:177665500-177665522 TATATTGGTACAAGTTAGATTGG - Intergenic
984969420 4:185173932-185173954 TGAATGTGTACACGTTAAATGGG + Intronic
986699706 5:10394088-10394110 TGAATTGGAATGCTTTAGAATGG + Exonic
988988221 5:36642586-36642608 TTAAATTGTACACTTTAAATGGG - Intronic
989289295 5:39743984-39744006 TTTAATGGTACACTTTAAATGGG - Intergenic
990115077 5:52380185-52380207 TGAGATTGTACACTTTAAATGGG - Intergenic
990136844 5:52655588-52655610 TGGATGGGAACAGTTTAGATGGG - Intergenic
991558610 5:67924440-67924462 AGAAGTGGTGCACTTTAGAACGG - Intergenic
991959288 5:72027766-72027788 TTAAGTGGTACACTTTAGATAGG + Intergenic
993528746 5:88999756-88999778 TGAAGTGCTACACTATAAATTGG + Intergenic
993813782 5:92515441-92515463 TTGAGTGGTACACTTTAAATAGG + Intergenic
996050815 5:118930994-118931016 TTAATTTGTACATTTTAAATTGG + Intronic
996749837 5:126877279-126877301 GGGAATGGTACACTTTAGACAGG + Intronic
997516248 5:134491896-134491918 TTAATTTGTACCCTATAGATTGG - Intergenic
998312407 5:141147929-141147951 TAAAATGGTACAGTTAAGATTGG + Intronic
999170808 5:149593195-149593217 TTGATTTGTACACTTTAAATGGG - Intronic
999802607 5:155051881-155051903 TGGTTTTATACACTTTAGATAGG - Intergenic
1001461016 5:171914486-171914508 TGTATTGGTACACTCTAGTTTGG - Intronic
1002210849 5:177598556-177598578 TGGAGTGGTCCCCTTTAGATGGG + Intergenic
1005880943 6:30060633-30060655 TGAAGTGGTACACTTGAGAAGGG - Intronic
1007767193 6:44167607-44167629 CCAAATGGTACACTTTAAATGGG - Intronic
1008916724 6:56795855-56795877 TTAATTGGTACTATCTAGATTGG - Intronic
1009436952 6:63629810-63629832 TTGAGTGGTACACTTTAAATGGG + Intergenic
1009674625 6:66802141-66802163 TACATTGGAACACTGTAGATAGG - Intergenic
1010328575 6:74594274-74594296 TGCCTTAGGACACTTTAGATGGG - Intergenic
1011100140 6:83710751-83710773 TCAATTTGTACACTTAAAATTGG + Intergenic
1011370035 6:86627112-86627134 TGGATTCTTACACTTTACATAGG + Intergenic
1011913504 6:92472216-92472238 TAAAATTGTACACTTTAAATAGG + Intergenic
1013897616 6:115109300-115109322 TGAATTTGTACACTTGAAATGGG + Intergenic
1016024244 6:139269593-139269615 TGAATTTGTACAATTGAGTTAGG - Intronic
1017846920 6:158266549-158266571 TAAAATGGTACATTTTAGCTGGG - Intronic
1018570991 6:165209863-165209885 TCACTTGGTTCACTTCAGATCGG - Intergenic
1023647594 7:42335083-42335105 TTAAATGGTACACTTTAAATGGG + Intergenic
1023884869 7:44347538-44347560 TGAAATTGTACACTTTAAAAAGG + Intergenic
1026132015 7:67628763-67628785 TGAATCTGAACACTTTAAATGGG + Intergenic
1027114155 7:75465295-75465317 TGAATTGTAACACTTTAAAATGG + Intronic
1027286402 7:76649880-76649902 TGAATTGTAACACTTTAAAATGG - Intergenic
1027615824 7:80422895-80422917 TGATATGGTGCACTTTAAATGGG - Intronic
1028282436 7:88947822-88947844 TGAAATGGCACAGTGTAGATTGG - Intronic
1028770267 7:94611612-94611634 TAAAATTGTACATTTTAGATAGG + Intronic
1029799345 7:102929857-102929879 TGAAATTGTACACTTTAAGTGGG + Intronic
1030705634 7:112690017-112690039 TGACTTGGGACACTTGAGCTTGG - Intergenic
1032093471 7:128923782-128923804 TTAAATTGTATACTTTAGATGGG - Intergenic
1034521208 7:151621586-151621608 AGAGATGGTACACTTTAAATTGG - Intronic
1035840799 8:2810262-2810284 AGAAATGGCACAGTTTAGATGGG - Intergenic
1036956936 8:13198324-13198346 TGAATTGGTACCATTTACAAAGG + Intronic
1038028134 8:23610433-23610455 TTAAGAGGTACACTTAAGATGGG - Intergenic
1038612108 8:29067431-29067453 TGATTTGGTACACAGTAAATGGG - Exonic
1038974478 8:32677910-32677932 TGATTAGGTACACTTGATATAGG - Intronic
1041832953 8:62177932-62177954 TGAATCTGTACACTTTATATAGG + Intergenic
1045187385 8:99852931-99852953 TGACTTGGTGCACTTTGGAGAGG + Intronic
1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG + Intronic
1047755502 8:127915223-127915245 TGATTTTGTACACTTTAAAATGG + Intergenic
1049723608 8:144134178-144134200 TTAAATTGTACACTTTAAATGGG - Intergenic
1050164722 9:2752800-2752822 TGAAATAGTACAGTTTAGAAAGG + Intronic
1051214842 9:14785871-14785893 TGAACTGGTACACTTAAAAATGG + Intronic
1051794541 9:20850694-20850716 TTAATTGGCACAATTTAAATTGG + Intronic
1052419663 9:28226279-28226301 TAAATTGGTACACTTCAGATAGG - Intronic
1055182718 9:73407883-73407905 TGAAAAGGTACACTTAAAATTGG + Intergenic
1055601935 9:77928706-77928728 TAAATTTGTACACTTTAAAATGG + Intronic
1056129449 9:83569393-83569415 TGGGCTGGGACACTTTAGATTGG - Intergenic
1056697986 9:88876854-88876876 TGAGTTGGTACACTATACAAAGG - Intergenic
1058879868 9:109277022-109277044 TCATTTGGTAGGCTTTAGATAGG - Intronic
1058914290 9:109550669-109550691 TGACTTGGTAAACTTTTCATTGG + Intergenic
1059285548 9:113168810-113168832 GGAGTTGTTCCACTTTAGATAGG - Intronic
1186770981 X:12818009-12818031 TGAATTAATACACTTTAAAATGG + Intronic
1186773858 X:12844759-12844781 TTAACTGGTACAATTTACATCGG + Intergenic
1188372371 X:29384996-29385018 TAGAATGGTACACTTTAAATGGG - Intronic
1188518409 X:31011996-31012018 TGAATTCGTATTCTTTAAATGGG + Intergenic
1188901524 X:35738508-35738530 TATATTGGTACATTTTACATTGG - Intergenic
1189258060 X:39655566-39655588 GGTATTGGTAGGCTTTAGATAGG - Intergenic
1189410964 X:40770948-40770970 TCAAATTGTACACTTTAAATGGG + Intergenic
1190394765 X:49970293-49970315 TTAAATTGTACACTTTAAATGGG - Intronic
1191934104 X:66407808-66407830 TTAGTTTGTACACTTTAGATTGG + Intergenic
1192315817 X:70050592-70050614 TGATTTGTTTCACTATAGATTGG - Intergenic
1192539961 X:71959481-71959503 TTAAATTGTACACTTTAAATGGG - Intergenic
1194466577 X:94241136-94241158 TTAAATAGTACACTTTAAATGGG + Intergenic
1194855562 X:98923863-98923885 TTAAATTGTACACTTTATATGGG + Intergenic
1196501294 X:116386153-116386175 TGAAATGATACACTTTAGATGGG - Intergenic
1198238620 X:134761481-134761503 TAAATTGGTACAATCTTGATGGG + Intronic
1198711898 X:139513488-139513510 TTAAATTGTACACTTTAAATTGG - Intergenic
1199742962 X:150752723-150752745 TGAAATTGTACATTTTAGATGGG - Intronic