ID: 1167145072

View in Genome Browser
Species Human (GRCh38)
Location 19:47676498-47676520
Sequence CAGAAGAGGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3361
Summary {0: 1, 1: 0, 2: 55, 3: 427, 4: 2878}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167145072_1167145083 24 Left 1167145072 19:47676498-47676520 CCTTCCTCCTTCTCCCTCTTCTG 0: 1
1: 0
2: 55
3: 427
4: 2878
Right 1167145083 19:47676545-47676567 TTCCTCCCCCCACCTTCCTTCGG 0: 1
1: 1
2: 5
3: 39
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167145072 Original CRISPR CAGAAGAGGGAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr