ID: 1167145654

View in Genome Browser
Species Human (GRCh38)
Location 19:47679845-47679867
Sequence CACGGCGGCCACACTGGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167145642_1167145654 4 Left 1167145642 19:47679818-47679840 CCTGCCCAATGGCAGCCCTGGGG 0: 1
1: 0
2: 3
3: 42
4: 336
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145634_1167145654 23 Left 1167145634 19:47679799-47679821 CCATCCCGGGCCTCCAAGGCCTG 0: 1
1: 0
2: 0
3: 45
4: 370
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145645_1167145654 0 Left 1167145645 19:47679822-47679844 CCCAATGGCAGCCCTGGGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145638_1167145654 13 Left 1167145638 19:47679809-47679831 CCTCCAAGGCCTGCCCAATGGCA 0: 1
1: 0
2: 2
3: 15
4: 234
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145646_1167145654 -1 Left 1167145646 19:47679823-47679845 CCAATGGCAGCCCTGGGGGTGCC 0: 1
1: 0
2: 0
3: 31
4: 277
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145636_1167145654 18 Left 1167145636 19:47679804-47679826 CCGGGCCTCCAAGGCCTGCCCAA 0: 1
1: 0
2: 3
3: 34
4: 352
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145635_1167145654 19 Left 1167145635 19:47679803-47679825 CCCGGGCCTCCAAGGCCTGCCCA 0: 1
1: 1
2: 4
3: 66
4: 466
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145633_1167145654 24 Left 1167145633 19:47679798-47679820 CCCATCCCGGGCCTCCAAGGCCT 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186
1167145639_1167145654 10 Left 1167145639 19:47679812-47679834 CCAAGGCCTGCCCAATGGCAGCC 0: 1
1: 0
2: 0
3: 29
4: 324
Right 1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167145654 Original CRISPR CACGGCGGCCACACTGGGCC TGG Exonic
900514533 1:3074959-3074981 CACGGTGGTCATCCTGGGCCAGG + Intronic
901650315 1:10739362-10739384 CACCGTGGCCACCCTGGGCCCGG - Intronic
902802297 1:18838087-18838109 CACAGTGGCCAGACAGGGCCTGG + Intergenic
903630871 1:24769348-24769370 AACGGCTGGCACACTGTGCCTGG - Intronic
903649053 1:24911994-24912016 CAAGGCGGCCCCACGTGGCCAGG + Intronic
904877558 1:33668173-33668195 CATGGAGGCGACACTGGGCCAGG + Intronic
905731352 1:40301267-40301289 CCCGGCAGCCCCACGGGGCCTGG + Exonic
906040752 1:42786130-42786152 CTTGGAGGCCACACTGGGCAGGG + Intronic
906532820 1:46533209-46533231 CGCGGCCGCCACCCTGGCCCGGG + Intergenic
906536804 1:46555262-46555284 CACAGCTGCCCCTCTGGGCCAGG + Intergenic
911078797 1:93908718-93908740 CACGGAGGTCACAGAGGGCCAGG - Intronic
912473855 1:109923718-109923740 CACGGGGCCCACCCTGGGCAAGG - Exonic
913998073 1:143667785-143667807 CACGGCGGGCAAACCAGGCCTGG + Intergenic
915146110 1:153796569-153796591 CCCAGTGCCCACACTGGGCCTGG - Intergenic
915489705 1:156244251-156244273 CACAGTGGCCACACTGGTCTTGG - Exonic
915552375 1:156642567-156642589 CTCGGCGGCCGCGCTGGGACAGG - Intronic
916684034 1:167128301-167128323 CACAGCGCCCAAATTGGGCCAGG + Exonic
921017631 1:211207155-211207177 CGCGGGGGCCGCGCTGGGCCGGG - Intergenic
921060281 1:211579122-211579144 CACGGCAGCTGCACTCGGCCCGG + Intergenic
923121066 1:230991968-230991990 CACGGCTGCCACACTGTTGCAGG + Intronic
1068083304 10:52346649-52346671 CAGAGCGGCGACACAGGGCCAGG - Intergenic
1070112059 10:73495878-73495900 CGGGGCGGCCATGCTGGGCCCGG + Exonic
1072470386 10:95707425-95707447 CAGGGAGGCCCCGCTGGGCCTGG - Intergenic
1073123131 10:101133913-101133935 CACGGAGGCCTCCCTGGCCCCGG - Intronic
1076352240 10:129825252-129825274 CAAGGCTGCCTCCCTGGGCCGGG + Intergenic
1076388807 10:130080576-130080598 CATGGAGGCCACCCTGGCCCAGG + Intergenic
1076634306 10:131872619-131872641 CAGGGCGGCCTCACAGGCCCAGG + Intergenic
1077094688 11:794350-794372 CAGGGCGGCCAGCCTGGGCCTGG - Intronic
1077143821 11:1036116-1036138 CACGGCGGCCACACCAGGGGAGG + Intronic
1077230339 11:1455759-1455781 CACAGCCGCCTCACTGGGGCCGG - Intronic
1077443072 11:2577756-2577778 CAGGGCGGCCCCACGGGGGCTGG + Intronic
1078368203 11:10723702-10723724 GAGAGCGGCCACACTGGGCGCGG - Intergenic
1078462115 11:11522055-11522077 CATGTCAGCCACACTGGGGCGGG + Intronic
1079058577 11:17228368-17228390 CACGGCCGCTACCCTGGCCCCGG - Intronic
1081603833 11:44514433-44514455 CAGGCATGCCACACTGGGCCTGG - Intergenic
1083299070 11:61730846-61730868 CAGGGCAGCCACGCTAGGCCAGG - Intronic
1083989820 11:66240126-66240148 CAGGGCTGCCTCACTGTGCCAGG - Intronic
1084004761 11:66316973-66316995 CGCAGGGCCCACACTGGGCCAGG - Exonic
1084730839 11:71072339-71072361 CACGGTGCACACACTGGGCGGGG + Intronic
1084814691 11:71639338-71639360 CACCGCGGACACGCCGGGCCGGG - Intergenic
1089405121 11:118191535-118191557 CAGCGCGGGGACACTGGGCCTGG - Intergenic
1089497152 11:118913622-118913644 GGCGGCGGGCACTCTGGGCCAGG + Intronic
1091209195 11:133842211-133842233 GGCCGTGGCCACACTGGGCCTGG + Intronic
1096691797 12:53325900-53325922 CCCGGCGGGCAGACTGGGCCTGG - Intergenic
1103407714 12:120687382-120687404 CACGCCGGCCACGCCGAGCCCGG - Exonic
1103800040 12:123532324-123532346 CAGGGCCTCCCCACTGGGCCTGG - Intronic
1103918853 12:124389237-124389259 CACGGCTGCCCTGCTGGGCCTGG - Intronic
1105015815 12:132786359-132786381 CACTGCTGCCACCCTGGGCTCGG + Exonic
1108727888 13:53201553-53201575 CACGGTGGCCGCCCTGGACCCGG + Intergenic
1112589207 13:100748428-100748450 CATGGAGGCCACACTGCCCCAGG + Intergenic
1113717205 13:112519827-112519849 CACCGAGGACCCACTGGGCCGGG - Intronic
1119249062 14:73136648-73136670 CCGGGCGGCCACAAAGGGCCGGG - Intronic
1119707245 14:76790698-76790720 CTGGGCGGCCACGCTGGGGCAGG + Exonic
1124340290 15:28885966-28885988 CGCGCCGGGCACACTGGGGCCGG - Exonic
1129098326 15:73233233-73233255 CACTGGGGCCACAGTGGGCATGG + Intronic
1129666998 15:77584879-77584901 GCCGGGGGCCACACTGGGGCCGG - Intergenic
1132544466 16:527043-527065 CACGGCGCCCAACCAGGGCCTGG - Intergenic
1132557312 16:578347-578369 CACAGGGGCCACGCTGGGGCGGG - Intronic
1132590589 16:724690-724712 TACGGCTGCAACACTGCGCCTGG - Exonic
1132611324 16:817695-817717 CCGGGCGGCCCCACGGGGCCCGG + Intergenic
1132945494 16:2529673-2529695 CAGGGCGGCCGCACAGGCCCTGG - Intronic
1132998116 16:2834594-2834616 CATGGTGGCCAGGCTGGGCCTGG - Intronic
1133369921 16:5239675-5239697 CACCGCGGACACGCCGGGCCCGG - Intergenic
1133784268 16:8963088-8963110 CCCGGCGGCCGCCCGGGGCCTGG + Intronic
1135328499 16:21542882-21542904 CACCGGGGCCACACTGGGGCTGG + Intergenic
1135330290 16:21554794-21554816 AACGGCGGCCACCCTGGGCTGGG + Intergenic
1136282304 16:29220991-29221013 CACGCCGGAGACACTGGACCCGG + Intergenic
1136338845 16:29628855-29628877 CACCGGGGCCACACTGGGGCTGG + Intergenic
1139480995 16:67230641-67230663 CACGGCGGGCACACTGGTCCAGG + Exonic
1139773984 16:69302066-69302088 CACTGCTGCCACAAAGGGCCAGG - Exonic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1142043328 16:87909326-87909348 AACGGCGGCCACCCTGGGCTGGG + Intronic
1142086676 16:88186909-88186931 CACGCCGGAGACACTGGACCCGG + Intergenic
1142592697 17:1013335-1013357 CACGGCGGCCACAGGGGCCTGGG - Intronic
1142993983 17:3750365-3750387 CACCGTGGGCACTCTGGGCCAGG - Exonic
1143158928 17:4856483-4856505 CACAGCTGCCGCACAGGGCCTGG + Intronic
1143840085 17:9725047-9725069 CAAGGTGGCCACACAGGGACAGG + Intronic
1144803031 17:17944206-17944228 CACGGCAGCCACTTTGTGCCAGG - Intronic
1144891409 17:18496367-18496389 CACGGCTGCCACGCAGGGCAGGG + Intergenic
1145023016 17:19446732-19446754 CACGGCCGCGACCCTGGCCCCGG + Intergenic
1145140812 17:20447950-20447972 CACGGCTGCCACGCAGGGCAGGG - Intergenic
1148080999 17:44967759-44967781 CCCGGCGGCCCCACAGGGCCGGG + Exonic
1151482707 17:74379772-74379794 CACGTCTGCCACGCTGGGGCTGG + Intergenic
1151553211 17:74833932-74833954 TACAGAGGCCAGACTGGGCCCGG - Intronic
1152520825 17:80855661-80855683 CACGGTGGACACACTCGCCCTGG - Intronic
1152539218 17:80966530-80966552 CACTGTGGCCACAGGGGGCCTGG + Intergenic
1152543989 17:80991813-80991835 TACGGCGGCCGCGCCGGGCCAGG - Intronic
1152643136 17:81457491-81457513 CAGCACGGCCACACTGGCCCCGG - Exonic
1152894130 17:82900929-82900951 CACGTCGGACACACTGGACCAGG - Intronic
1161000346 19:1907683-1907705 CACGGCCGCCAGCCTGGGCTGGG - Intronic
1161028915 19:2049058-2049080 AACGGTGGCCAGACAGGGCCAGG - Intronic
1161086449 19:2337784-2337806 CCCCACGGCCACACTCGGCCCGG - Intronic
1161302076 19:3547618-3547640 CAGGGCGCCCACCCTGGCCCCGG - Intronic
1162840982 19:13356236-13356258 CACGGAGGTCACCCCGGGCCAGG + Intronic
1163262697 19:16200669-16200691 CAGCGTGGCCACACTGGGCTGGG + Intronic
1164615748 19:29665868-29665890 CCCGGCGGCCACACGAGGCCAGG - Intronic
1165233772 19:34404482-34404504 CACGGCAGCCCCACAGGGCCGGG + Exonic
1165403585 19:35617157-35617179 CACGTCGGCAGCTCTGGGCCTGG + Exonic
1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG + Exonic
1167297731 19:48661764-48661786 CATGGAGGCCGCGCTGGGCCCGG - Exonic
1168241455 19:55091159-55091181 CCAGGCGGCCACTCTGGTCCTGG + Exonic
927206875 2:20616599-20616621 CCCGATGACCACACTGGGCCTGG + Intronic
929001328 2:37349959-37349981 CACACAGGCCACACAGGGCCTGG - Intronic
935107323 2:100057027-100057049 AACTTTGGCCACACTGGGCCAGG + Intronic
937211785 2:120278364-120278386 CACGCCCGCCTCACTGGGCAGGG - Intronic
937243476 2:120477313-120477335 CAGGGGCTCCACACTGGGCCAGG - Intergenic
942531669 2:176916911-176916933 CAGGCCCGCGACACTGGGCCTGG + Intergenic
944316726 2:198292556-198292578 CAGGGAAGCCACACTGGGACGGG - Intronic
944933780 2:204545970-204545992 CCCGGCGACCACGCCGGGCCGGG - Intronic
945357529 2:208857405-208857427 GACGCCAGCCATACTGGGCCTGG - Intergenic
949040169 2:241844291-241844313 CCCGGCGGCGACACAGGCCCGGG + Intergenic
949052302 2:241903766-241903788 TAGGGCGTCCACACTGGGCCAGG - Intergenic
1169367165 20:5001205-5001227 CCCGCCGGCCACCCTGGCCCCGG - Intronic
1171208239 20:23297647-23297669 CACGGAGGCCACACTGTGCAGGG + Intergenic
1172655351 20:36533518-36533540 CACGGGGGCTTCACTGGGTCTGG - Intergenic
1173189627 20:40866124-40866146 CACGGCTTCCACCCTGAGCCAGG + Intergenic
1174332722 20:49832564-49832586 TAAGGCAGCCACACTGGGGCAGG + Intronic
1175149868 20:56925272-56925294 GACGGCGCGCACAATGGGCCCGG + Intergenic
1175913923 20:62416909-62416931 CACGGAAGCCACAGAGGGCCTGG + Intronic
1175935760 20:62513321-62513343 CACGGCGGCCACCATGGCTCCGG - Intergenic
1176429417 21:6566896-6566918 GACACCGGCCAGACTGGGCCAGG - Intergenic
1179059501 21:37966467-37966489 CACGGCAGCTGAACTGGGCCCGG + Intronic
1179580488 21:42340325-42340347 CAGGGCAGCCTCACTGGGGCTGG + Intergenic
1179600168 21:42472132-42472154 CAGGGCCCCCACAGTGGGCCTGG + Intergenic
1179704811 21:43174358-43174380 GACACCGGCCAGACTGGGCCAGG - Intergenic
1180622556 22:17171737-17171759 CACCGCAGCCACCCGGGGCCCGG + Intergenic
1182149785 22:28019955-28019977 CACGGCGGCCTCACCGGCTCAGG + Intronic
1182424200 22:30263640-30263662 CCCGGCCACCCCACTGGGCCTGG + Exonic
1184138024 22:42560932-42560954 CACTGCAGCCTCACTGAGCCGGG - Intronic
1185320041 22:50196410-50196432 CCCGGGGGCCACACAGCGCCGGG - Intronic
952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG + Intergenic
952998550 3:38908897-38908919 CAAGGCTGCCACCCTTGGCCTGG - Intronic
953383947 3:42494078-42494100 CACGGCTGCCCCACTGGGGAAGG - Intronic
956614436 3:71156893-71156915 CCTGCCTGCCACACTGGGCCAGG + Intronic
959360247 3:105380825-105380847 CACGACGGCCATACTGGGAAAGG + Intronic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961873305 3:130003197-130003219 CACCGCGGACACGCCGGGCCGGG + Intergenic
967975293 3:195030984-195031006 CGCTGCGGTCACACTGGGCCAGG - Intergenic
968897426 4:3412930-3412952 CAGGCCGGCCACTCTGGGACAGG + Intronic
969535376 4:7753462-7753484 CACGGCGTCCGCTCTGTGCCAGG - Intergenic
969737351 4:9000629-9000651 CACCGCGGACACGCCGGGCCGGG - Intergenic
969796559 4:9532217-9532239 CACCGCGGACACGCCGGGCCGGG - Intergenic
974116952 4:57590628-57590650 CACTGCTGCCACAGTGGGTCTGG + Intergenic
985481078 5:111311-111333 CACTGGGGCCACTCAGGGCCTGG - Intergenic
985578504 5:684670-684692 CACGGTGTCCACCCTGGGCATGG - Intronic
985694280 5:1331201-1331223 CACGGCAGGCACCCTTGGCCAGG + Intronic
986443549 5:7801397-7801419 CACTGCGTCCACAGTGGCCCCGG + Intronic
990864564 5:60366681-60366703 AACGGCAGCCACACTTGGCTTGG - Intronic
991330240 5:65485693-65485715 CCCGCCGGCCCCACTGGCCCCGG - Intergenic
997208918 5:132066453-132066475 CACAGCGGCCAGTCTGGGCTGGG - Intergenic
998415707 5:141944867-141944889 CAAGACCGTCACACTGGGCCTGG - Exonic
999238285 5:150113077-150113099 CCCGGCAGCAACACAGGGCCAGG - Intronic
1000095715 5:157969219-157969241 CACTGCGCCCGGACTGGGCCAGG + Intergenic
1001773308 5:174311601-174311623 CACGGCAGCCTCCTTGGGCCAGG - Intergenic
1002643456 5:180641375-180641397 TGCGGTGGCCACCCTGGGCCTGG + Intronic
1003840384 6:10113399-10113421 CCCGGCGCCCCCGCTGGGCCAGG - Intronic
1006792648 6:36714059-36714081 CCCGGCTGCCACAGTGGTCCGGG + Intronic
1007889268 6:45271343-45271365 CACCGCGGGGACCCTGGGCCTGG - Intronic
1016936882 6:149454440-149454462 TATGGAGGCCACACAGGGCCGGG - Intronic
1017426729 6:154329929-154329951 CACGGAGGCCAGAGTGGGGCTGG - Intronic
1020091781 7:5345877-5345899 CCCAGAGGCCACTCTGGGCCAGG - Intronic
1021584757 7:22196030-22196052 CACAGCAGCCACACTCTGCCAGG + Intronic
1023881901 7:44325494-44325516 CACGGCGGCGACACGGGCGCGGG + Exonic
1024644542 7:51360209-51360231 CACTGTGGCCATACTGTGCCAGG + Intergenic
1026330497 7:69348082-69348104 CACCGCGCCCCCACTGCGCCCGG - Intergenic
1027266517 7:76497885-76497907 CGTGGCGGCCACACAGGGCTGGG - Intronic
1027317898 7:76996003-76996025 CGTGGCGGCCACACAGGGCTGGG - Intergenic
1027361721 7:77416372-77416394 CGAGGCGGCCACGCGGGGCCGGG - Exonic
1027520827 7:79204344-79204366 CAGGCCGGCCTCAGTGGGCCTGG + Intronic
1030870902 7:114755152-114755174 CACGTCGGCCATGCTGAGCCCGG - Intergenic
1034324662 7:150219982-150220004 CCCGCCGGCCACCCTGGGGCTGG - Intergenic
1034768530 7:153749249-153749271 CCCGCCGGCCACCCTGGGGCTGG + Intergenic
1038581237 8:28751029-28751051 GAAGTCAGCCACACTGGGCCTGG + Exonic
1047775966 8:128070724-128070746 CTCAGTGGCCAAACTGGGCCAGG + Intergenic
1048009630 8:130445151-130445173 GACGGCAGCTACAGTGGGCCTGG - Intergenic
1049176636 8:141196908-141196930 CACGGCAGACGCACTGGGGCCGG + Intergenic
1049471062 8:142775205-142775227 CACCCCGGCCACCCTGGCCCTGG - Intronic
1049788494 8:144462544-144462566 CCCGGCGGCCGCCCCGGGCCCGG + Intronic
1053006158 9:34606010-34606032 CAAGGCATCCAAACTGGGCCAGG - Intergenic
1053351651 9:37417265-37417287 CACGTTGGCCACACTGTTCCAGG + Intergenic
1057043771 9:91867753-91867775 CACTGTGGCCAGACTGGGACGGG - Intronic
1057398450 9:94701265-94701287 CAAGGCGGGCATACAGGGCCAGG - Intergenic
1061226029 9:129281552-129281574 CTCGGCGGCCTCTCTGGGGCAGG - Intergenic
1061670800 9:132187140-132187162 CAGGGGGGCCACAGTGGGCATGG - Intronic
1062236683 9:135513643-135513665 CACGTGGGCCACGCAGGGCCAGG - Intergenic
1062344120 9:136107026-136107048 CACGGCTGCCGCAGTGGGCCAGG - Intergenic
1062402612 9:136379084-136379106 CAGGGAGGCCACCCGGGGCCCGG - Exonic
1062509861 9:136898875-136898897 ACCGGTGGCCACACTGCGCCTGG - Exonic
1062732271 9:138116829-138116851 CACTGCGGCCGCTCTGTGCCTGG + Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1186409700 X:9336021-9336043 CACGGCAGGCACATGGGGCCAGG + Intergenic
1186433415 X:9523423-9523445 CAAGTCACCCACACTGGGCCAGG + Intronic
1186506837 X:10100469-10100491 CACCGCGGCCATGCTGAGCCGGG - Intronic
1190118938 X:47644783-47644805 GACGGGGGCCAGACTGAGCCAGG + Intronic
1192157209 X:68755467-68755489 CGAGGCAGGCACACTGGGCCAGG - Intergenic
1201770229 Y:17611626-17611648 CACAGCGGCCACTCTGAGGCTGG - Intergenic
1201831325 Y:18294361-18294383 CACAGCGGCCACTCTGAGGCTGG + Intergenic