ID: 1167149398

View in Genome Browser
Species Human (GRCh38)
Location 19:47700061-47700083
Sequence GAGTCTGAAGTCTCTAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167149394_1167149398 2 Left 1167149394 19:47700036-47700058 CCATAGTGAAGGAGGGGCCAGGA 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG 0: 1
1: 0
2: 3
3: 29
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167149398 Original CRISPR GAGTCTGAAGTCTCTAGGGT AGG Intronic
901104203 1:6742886-6742908 GAGTCTGATGTTTCGAGGGCAGG + Intergenic
901781356 1:11596889-11596911 GAGTCTGAGGGCCCTGGGGTTGG + Intergenic
902198945 1:14819639-14819661 AAGTCTGAAGTGTGTAGGGCAGG - Intronic
903667692 1:25017905-25017927 CAGTCTGCTGTCTGTAGGGTGGG + Intergenic
906073848 1:43036982-43037004 AAGTCTGAAGCCTGTAGGGTAGG - Intergenic
907417820 1:54326639-54326661 GAGTCAGAATGCTCTGGGGTCGG - Intronic
907627518 1:56044589-56044611 AAGTCTGAAATCTGTAGGGCAGG + Intergenic
908829695 1:68166864-68166886 GAGTCTGGTATTTCTAGGGTAGG - Intronic
909308793 1:74118762-74118784 AAGTCTGAAATCTGTAGGGCAGG + Intronic
910402693 1:86853207-86853229 GAGTCTGAAACCTCTAGGGAGGG + Intergenic
911594968 1:99788992-99789014 GAGTCTGAAATCCACAGGGTAGG + Intergenic
913479755 1:119276689-119276711 AAGTCTGAAGTCTGTAGGGCAGG + Intergenic
914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG + Intergenic
915481625 1:156190176-156190198 AAGTCTGAAATCTGTAGGGCAGG + Intergenic
916039528 1:160950487-160950509 GAGATCGAAGTGTCTAGGGTAGG - Intronic
916489508 1:165289055-165289077 GAGGCTGGAGTCTCTGGTGTGGG - Intronic
916884753 1:169056206-169056228 GAGACTGAAGCATCTAGAGTTGG - Intergenic
917825295 1:178813679-178813701 AAGTATGAAATCTGTAGGGTAGG + Intronic
922027869 1:221768903-221768925 AAGTCTGAAATCTGTAGGGCAGG - Intergenic
922556325 1:226535223-226535245 AAGTCTGAAGTCTGTAGGGCAGG + Intergenic
923068458 1:230541401-230541423 AAGTCTGAAATCAATAGGGTGGG + Intergenic
923977528 1:239280665-239280687 GAGTCTGAAATTCATAGGGTAGG - Intergenic
924026042 1:239833717-239833739 GAGTCTGAAGGCTCTGGCTTGGG + Intronic
1064909744 10:20386985-20387007 GATCCTGAAGTGTCTAGTGTTGG - Intergenic
1066535388 10:36385385-36385407 GAGTCTGGAGTCTGTAGGCCTGG + Intergenic
1067156557 10:43785911-43785933 GAATCAGAAGTCACTAGGGGTGG + Intergenic
1067670673 10:48318119-48318141 AAGTCTGAAATCTGTAGGGCAGG + Intronic
1068324376 10:55465181-55465203 CAGTCTGAAATCTGCAGGGTAGG + Intronic
1068799303 10:61121464-61121486 CATTCTCAAGTATCTAGGGTTGG + Intergenic
1069087708 10:64160599-64160621 AAGTCTGAAGTCTGTAGGGCAGG + Intergenic
1070641377 10:78172874-78172896 GTGTCAGAAGTCTCCAGGTTGGG - Intergenic
1073031066 10:100526322-100526344 GGGAGTGAAGTCTCTGGGGTAGG - Intronic
1073607093 10:104907475-104907497 GAGGCTGAAGTATATGGGGTTGG - Intronic
1074303913 10:112258319-112258341 AAGTCTGAAATCTTTAGGGCAGG - Intergenic
1075215260 10:120527215-120527237 AAGTCTGAAATCTATAGGGCAGG + Intronic
1075342684 10:121660183-121660205 AAGTCTGAAATCTGCAGGGTAGG + Intergenic
1078080197 11:8198597-8198619 GGCACTGAAGTCTCAAGGGTAGG - Intergenic
1079509438 11:21194195-21194217 GAGTCTGGAGGCTACAGGGTAGG - Intronic
1080640508 11:34155735-34155757 GAGGCTGACATCTCCAGGGTGGG - Intronic
1082037378 11:47656364-47656386 AATTCTGAAGTCTCTTTGGTAGG - Intergenic
1087771971 11:102220653-102220675 GGGTCTGGAGTCTCTGAGGTTGG + Intronic
1089465468 11:118682433-118682455 AAGTCCAAAATCTCTAGGGTAGG + Intergenic
1089699028 11:120233257-120233279 GAGTCTGAAATTTGTAGGGCAGG + Intergenic
1090401302 11:126449976-126449998 GAGTCGGAAGTCTCTTTTGTCGG + Intronic
1091152132 11:133338623-133338645 AGGGCTGAAGTCTCTAGGGCGGG + Intronic
1093916443 12:24807610-24807632 GAGTCTGAAATCTGCAGGGCAGG + Intergenic
1094066141 12:26362781-26362803 GAGTGTGAAGGTTCTAGGATAGG - Intronic
1095210331 12:39486378-39486400 AAGTCTGAAGTTTGTAGGGTAGG - Intergenic
1095954458 12:47798360-47798382 GTGTCTGGAGGCTCTAGGGAGGG - Intronic
1096779582 12:53984417-53984439 GAATCTCCAGCCTCTAGGGTGGG - Intergenic
1097544464 12:60981767-60981789 GAGCTTTAAGTCTCTAGGGGTGG - Intergenic
1099512779 12:83557424-83557446 GTCTCTGAAGGCTCTAGGGGAGG + Intergenic
1100095055 12:91023814-91023836 GAGTCTAAAGTTTGTAGGGCAGG + Intergenic
1101751841 12:107588408-107588430 GACTCTGAAGTTTCTAGCATGGG + Intronic
1102260614 12:111440992-111441014 GAGTCTGCATTTTCTAAGGTGGG - Intronic
1102625664 12:114233577-114233599 AAGTCTGAAATCTGTAGGGCAGG - Intergenic
1103544492 12:121690243-121690265 GAGCCTGAAGTCTGCAGGGCAGG - Intergenic
1103571261 12:121846671-121846693 GAGACTGAACTCTCTGGGGGTGG + Intronic
1104205606 12:126635423-126635445 GTGGCTGAAGTCTCCAGGGCAGG + Intergenic
1106786640 13:33113988-33114010 GTGTCTGAATTCTCAAGGGGTGG + Intronic
1108123062 13:47210620-47210642 GAGAGTGCAGTCTCTAGGCTGGG - Intergenic
1110548816 13:76789122-76789144 AAGTCTGAAGACTCTAGATTGGG - Intergenic
1111461469 13:88548012-88548034 CTCTCTGAAGTCTCTAGGGAGGG - Intergenic
1111748212 13:92296331-92296353 GAGTCTTCAGTTACTAGGGTGGG + Intronic
1113191472 13:107752691-107752713 GAGTCTGTAGTCTCTTTGGAAGG - Intronic
1117071781 14:52064041-52064063 CAGTCTGAACTCTCTTGGATGGG + Intronic
1119142338 14:72278728-72278750 GAGTTTGAAGTCTGTAGGATAGG + Intronic
1120264124 14:82227288-82227310 GCGTCCGAAGTCTCTAGCTTGGG + Intergenic
1120815027 14:88847100-88847122 GAGTCAGAATCCTCAAGGGTAGG + Intronic
1121161568 14:91746219-91746241 AAGCCTGAAGTCTGTAGGGCAGG - Intronic
1121187641 14:91990006-91990028 AAGTCTGAAATTTGTAGGGTTGG - Intronic
1121284892 14:92727494-92727516 GAGTGTGGAGACTCCAGGGTTGG - Intronic
1124908869 15:33898441-33898463 GTCTCTGAAGGCTCTAGGGGAGG + Intronic
1127166655 15:56250679-56250701 AAGTCTGAAATCTGTAGGGAAGG + Intronic
1129074817 15:72984811-72984833 GAGTCTGAAATCCATAGGGCAGG + Intergenic
1129223799 15:74153603-74153625 GAGTTTGAAGTCTGCAGGGCAGG + Intergenic
1129977711 15:79836307-79836329 AGGTCTGAGGTGTCTAGGGTGGG - Intronic
1130375515 15:83325608-83325630 AAGTCTGAAATCTGTAGGGCAGG - Intergenic
1131135720 15:89933615-89933637 GATCCTGATGTCACTAGGGTGGG - Intergenic
1132382723 15:101377800-101377822 GGGTCTGAAGTGTCTTGTGTGGG + Intronic
1133705287 16:8348922-8348944 TTGGCTGAAGTCTGTAGGGTGGG + Intergenic
1133822054 16:9245677-9245699 AAGTCTGAAGTCTGTAAGGCAGG + Intergenic
1134318447 16:13140748-13140770 GAGTGTGAATTCTGTAGGGAGGG + Intronic
1135961323 16:26996754-26996776 GAGTCTGAGGTCCCTGGGGATGG - Intergenic
1138939302 16:61770851-61770873 GTGTCTGAAGTGCCTAGGATAGG + Intronic
1141031022 16:80588809-80588831 GAATCTGAGTCCTCTAGGGTTGG - Intergenic
1141225714 16:82113237-82113259 CCATCTAAAGTCTCTAGGGTGGG + Intergenic
1144583758 17:16475384-16475406 GAGTCTGAAATCTGCAGGGCAGG + Intronic
1145776072 17:27529913-27529935 GAATCTGAGGTCTTTAGGGTAGG + Intronic
1146831473 17:36073069-36073091 GAGTCTGAAGGCTCAAGAATCGG - Intergenic
1147511632 17:41074555-41074577 GAGGCTGAAGTAGCTAGGGGAGG - Intergenic
1148700019 17:49581626-49581648 CAGTCTCAAGCCTCCAGGGTGGG - Intronic
1151649411 17:75456939-75456961 GAGTCTGAAGACTCGGGGGAAGG - Intronic
1152268761 17:79311498-79311520 GAATCTGAACTCTGTAGGATGGG - Intronic
1152575784 17:81140456-81140478 GAGTCTCAAGTTTCGAGGATCGG - Intronic
1155580945 18:27305764-27305786 AAGTCTGAAATCTGTAGGGTAGG - Intergenic
1155932451 18:31721734-31721756 GAGTCTGAAATTTGTAGGGCAGG - Intergenic
1156496466 18:37529023-37529045 GAGGATGGAGGCTCTAGGGTAGG + Intronic
1157640467 18:49207749-49207771 AAGTCTGAAATCTGTAGGGCAGG - Intronic
1157817266 18:50738694-50738716 AAGTCTGAAGTCTTCGGGGTGGG - Intergenic
1158334645 18:56402689-56402711 CAGAATGAAGTCACTAGGGTGGG + Intergenic
1158623122 18:59049719-59049741 GAGTCTGCAGGCTGTTGGGTGGG - Intergenic
1158982386 18:62776193-62776215 GAGTTTGAAGTTTGTAGGGCTGG + Intronic
1158982392 18:62776259-62776281 GAGTCTAAAATCTGTAGGGCAGG + Intronic
1161041828 19:2114532-2114554 GACTCTGAAGTCTCCAGGCCTGG - Intronic
1162194648 19:8975077-8975099 GAGACTGAATTCTCATGGGTAGG + Exonic
1164219982 19:23184634-23184656 TAGTCTGAGGTCTCCTGGGTTGG + Intergenic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925500837 2:4502903-4502925 GATTCTGAAGTGTTTAGGGGTGG + Intergenic
926935401 2:18082709-18082731 GAGTCAGAAATCTCTAAGGTGGG + Intronic
927131628 2:20065070-20065092 GAGTCTGAAATTCCTAGGGCAGG - Intergenic
927616067 2:24597562-24597584 GAGTCTGAAATCTGTAGAGTGGG + Intronic
929600178 2:43199817-43199839 GAGTCGGAACTCTGCAGGGTTGG - Intergenic
930386326 2:50699757-50699779 GAGTATCATGTGTCTAGGGTAGG - Intronic
932465618 2:71922290-71922312 GAGTCTGATGCCACTAGGGCTGG + Intergenic
933007556 2:77015191-77015213 AAGTCTGAAATCTCTAGGGTAGG - Intronic
935366413 2:102296153-102296175 CAGTTAGAAGTCTCTTGGGTGGG + Intergenic
935524880 2:104153285-104153307 GTGCCTGAAATCACTAGGGTTGG + Intergenic
937710810 2:124978275-124978297 GAGTCTGAAGTGTCCTGGGTGGG - Intergenic
937921017 2:127130822-127130844 GAGTCTGAAATCTGTAGGGCAGG + Intergenic
940725248 2:157329474-157329496 GAGCCTGAAGTCTGCAGGGCAGG + Intergenic
942050901 2:172139893-172139915 GAGTCTGAACTCTCTGGATTAGG - Intergenic
943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG + Intronic
944392093 2:199228310-199228332 GAGTCTGAATTCTCTAGCCATGG + Intergenic
944882308 2:204026111-204026133 CTGTCTGAAGGCTCTAGGGGAGG + Intergenic
945211319 2:207386070-207386092 GAGTCAGAAGTCTGTAGAGCAGG + Intergenic
946054525 2:216889210-216889232 GAGTCTGGAGTCTCAAGAGATGG + Intergenic
947736806 2:232459407-232459429 AAATCTGCAGTCTCTGGGGTTGG - Exonic
947982155 2:234419854-234419876 AAGTCTGAAATCTGCAGGGTAGG + Intergenic
1169280139 20:4260187-4260209 AAGTCTGAAATCTGTAGGGCAGG + Intergenic
1170306822 20:14947640-14947662 GAGTCAGAACTCTGCAGGGTGGG - Intronic
1171183813 20:23110737-23110759 CACTCTGAAGCCTCTAGGGAAGG + Intergenic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1172554177 20:35826433-35826455 GAGTCTGAAATAACCAGGGTTGG + Intronic
1173459692 20:43233276-43233298 GTCTCTGAAGTCTCGAGGGGAGG - Intergenic
1173471982 20:43331024-43331046 AAGTCTGAAATCTGTAGGGCAGG - Intergenic
1173525797 20:43731667-43731689 GAATCTGAAGTCTCCAGGCGAGG + Intergenic
1174922866 20:54723318-54723340 GGGGCAGAAGTCTCTAGGATTGG - Intergenic
1177133215 21:17282358-17282380 GTTTCTCAAATCTCTAGGGTAGG - Intergenic
1178285255 21:31320544-31320566 GAGTCTGAGGTCTCCAAGGCAGG + Intronic
1178381766 21:32115721-32115743 AAGTCTGAAGTCTCTAGGGCAGG - Intergenic
1178852894 21:36227938-36227960 GAGTAGAAAGTCTTTAGGGTTGG + Intronic
1181394212 22:22607401-22607423 GAGTCTGAATTCTGCAAGGTGGG + Intergenic
1181564532 22:23726897-23726919 GGGTGTGAAGTCTCTAAGGCAGG - Intergenic
1182038054 22:27214774-27214796 GAGTGTGGAGTCTCTAGATTTGG + Intergenic
1182208726 22:28655219-28655241 TAGTCTGTAATCTATAGGGTAGG - Intronic
1182804023 22:33055588-33055610 GAGTCTGCAGTCTAAAGGGGAGG + Intronic
1183758406 22:39792350-39792372 GAGTCTAAAGTCTCAGAGGTGGG - Intronic
1184749495 22:46477146-46477168 GAGTTTGGTGTCTCCAGGGTCGG - Intronic
1184823109 22:46926776-46926798 AAGTCTGAAATATGTAGGGTAGG - Intronic
1185147116 22:49144134-49144156 AAGTCTGAAATTTGTAGGGTAGG - Intergenic
949679324 3:6494850-6494872 GAGGCTGAAGTCAGCAGGGTAGG + Intergenic
950527935 3:13535582-13535604 GAGACTGAAGTCTCTCCGGAGGG + Intergenic
953542720 3:43836442-43836464 GAGTCTGAAGTATCTAATATTGG + Intergenic
955963705 3:64366468-64366490 AAGTCTGAAATCTGTAGGGCAGG + Intronic
956777978 3:72581678-72581700 AAGTCTGAAATTTGTAGGGTAGG + Intergenic
958587782 3:96113595-96113617 AAGTCTGAACTCTGTAAGGTGGG - Intergenic
960249876 3:115440076-115440098 AAGTCTGAAATCTATAGGGCAGG + Intergenic
961038097 3:123657140-123657162 GAGTCTGAACTCACAACGGTAGG - Exonic
962017190 3:131453893-131453915 ACGTCTGAAGGCTCTAGGGGAGG - Intergenic
966489693 3:180514418-180514440 GAATCTGAAATCTGTAGGGCAGG + Intergenic
968131641 3:196195844-196195866 GGGTCTGAAGCCTGCAGGGTCGG + Intergenic
968281493 3:197480315-197480337 CTCTCTGAAGCCTCTAGGGTAGG + Intergenic
969666367 4:8559653-8559675 GAGTCTGAGGTCTATAGGGCAGG - Intronic
971490688 4:27209233-27209255 GAGAGTGTAGTTTCTAGGGTCGG + Intergenic
974435217 4:61848320-61848342 CCCTCTGAAGCCTCTAGGGTAGG + Intronic
974554356 4:63424996-63425018 GAATCTGAAATATATAGGGTGGG + Intergenic
974832696 4:67209222-67209244 CAGTCTTCAGTCTCTTGGGTAGG + Intergenic
975608150 4:76176827-76176849 GAGTTTGAAATCTGTAGGGTGGG - Intronic
975740967 4:77428534-77428556 AAGTTTGAAGTCTGTAGGGCAGG - Intronic
978122513 4:105097631-105097653 AAGTCTGAAATCTGTAGGGCAGG - Intergenic
981328040 4:143474752-143474774 AAGTCTGAAGTTGGTAGGGTAGG - Intergenic
982125510 4:152180660-152180682 GAGCCTGAATTCTCTAGACTGGG + Intergenic
984405452 4:179324132-179324154 AAGTCTGAAGTCTCTGGGGCGGG - Intergenic
984791444 4:183618538-183618560 AAGTCTGAAATCTCTAGGACAGG + Intergenic
985693865 5:1329062-1329084 GAGTCTGAGGTCTCTGCAGTTGG - Intronic
986692418 5:10324668-10324690 AAGTCTGAAATCTGTAGGGCAGG - Intergenic
987121986 5:14776343-14776365 GAGTCTGGAGTCTGGAGGGTCGG + Intronic
988376791 5:30446679-30446701 TAGTCTAATTTCTCTAGGGTTGG - Intergenic
988583922 5:32492536-32492558 GAGTCTGAAATCTGCAGGGCAGG + Intergenic
988704994 5:33717040-33717062 GAGTCATAACTCTATAGGGTAGG - Intronic
989773381 5:45171873-45171895 GAGTCTGAAGCCTGTGGGGAGGG - Intergenic
990056755 5:51591160-51591182 CAGTGTGAAGACTCTAGGGCAGG + Intergenic
990677785 5:58207692-58207714 GTCTCTGAAGCCTCTAGGGGAGG + Intergenic
990708742 5:58559621-58559643 AAGTCTGAAATCTGTAGGGCTGG - Intergenic
993381283 5:87211486-87211508 CAATCTGAGGTTTCTAGGGTGGG - Intergenic
993896957 5:93547059-93547081 AAGTCTGAAATCTGTAGGGCAGG - Intergenic
996073971 5:119167252-119167274 GAGACTAAAGTCTCCAGGGGCGG + Intronic
996121940 5:119682076-119682098 GATTCTGAGGGCTCTAGAGTAGG + Intergenic
996657502 5:125959160-125959182 AAGTCTGAAATCTGTAGGGGAGG - Intergenic
997671389 5:135677122-135677144 GAATCTGAATGCTCTAGTGTCGG + Intergenic
998090462 5:139364121-139364143 GATTCAGACATCTCTAGGGTGGG - Intronic
1000258468 5:159563153-159563175 AAGACTGAAGTCTCTGGAGTAGG + Intergenic
1000758598 5:165192343-165192365 GAGTCTGAAATCTGTAGGGCAGG + Intergenic
1001321299 5:170684356-170684378 GAGTCTAAAGTCTCTAGAGAAGG + Intronic
1001735429 5:173994624-173994646 AAGTCTGAAGTCTCTGTGCTGGG + Intronic
1001905921 5:175473102-175473124 AAGTCTGAAATCTCTAGCGCAGG - Intergenic
1007296542 6:40826484-40826506 GTCTCTGAAGCCTCTAGGGGAGG - Intergenic
1009237728 6:61144663-61144685 GAGTTTGAAGTTTGTAGGGCAGG + Intergenic
1009459432 6:63894473-63894495 CCGTCTGAAGGCTCCAGGGTAGG - Intronic
1010510259 6:76709386-76709408 GAGTCTGAAGTTTATAGGAAAGG + Intergenic
1010931989 6:81814820-81814842 GACTCTGAATTCTTAAGGGTGGG + Intergenic
1014307766 6:119763913-119763935 AATTCTGAAGTGTCTAGCGTGGG + Intergenic
1014928237 6:127300732-127300754 GGCTCTGAAGACTCTAGGGGAGG - Intronic
1015582997 6:134746600-134746622 GAGTCTCCAGTCTCTAAGGTTGG - Intergenic
1015667227 6:135645327-135645349 GAGTCTGAAATCAATAGGATAGG - Intergenic
1015950496 6:138547970-138547992 AAGTCTTAAGTCTCTAAGGTAGG - Intronic
1016003334 6:139065102-139065124 GAGTCTGAAATTTCTAGGACAGG + Intergenic
1017208863 6:151833281-151833303 TACTCTGAAGTCTTTTGGGTGGG + Intronic
1017375886 6:153767466-153767488 GTGTCTCAAAGCTCTAGGGTAGG - Intergenic
1018363205 6:163093656-163093678 GAGTCTGAAATCTTTTAGGTAGG - Intronic
1019933227 7:4237349-4237371 GATACTGAAGTCTCCAGGGCAGG + Intronic
1020096150 7:5370707-5370729 CAGTCTGACATTTCTAGGGTGGG + Exonic
1020861858 7:13503314-13503336 GAGTCTGAAATCTGAATGGTAGG - Intergenic
1020861863 7:13503380-13503402 AAGTCTGAATTCTGTAGGGCAGG - Intergenic
1022486493 7:30782764-30782786 AAGTCTGAAATCTGTAGGGCAGG + Intronic
1022908894 7:34881300-34881322 CCCTCTGAAGTCTCTAGGGGAGG + Intergenic
1022951026 7:35337992-35338014 CACTCTGAAGGCTCTAGGGTAGG - Intergenic
1024064855 7:45724103-45724125 AAGTCTGAAGTCTATAGGAAAGG + Intergenic
1024156289 7:46629146-46629168 AAGTCTGAAATCTCCAGGGCAGG + Intergenic
1026142667 7:67719565-67719587 AAGTCTAAAATCTGTAGGGTGGG - Intergenic
1026144344 7:67733535-67733557 AAGTCTAAAATCTGTAGGGTAGG + Intergenic
1027598577 7:80209314-80209336 AAGTCCGAAGTTTGTAGGGTAGG + Intronic
1028288610 7:89036775-89036797 GAGTCTGAAGTAGCTGGTGTTGG + Intronic
1028932671 7:96430527-96430549 CACTCTGAAGGCTCTAGGCTGGG + Intergenic
1029514602 7:101017631-101017653 GAGTCAACAGTCTCCAGGGTGGG - Exonic
1030747712 7:113188047-113188069 AAGTCTGAAATCTATAGGGTAGG - Intergenic
1031035024 7:116779527-116779549 GAGTCTGAAGCCATGAGGGTGGG - Intronic
1032159175 7:129497547-129497569 GAGAATGAAGTCTCTGGGCTTGG + Intergenic
1034914197 7:155023340-155023362 GCATCTGAAGTCTACAGGGTGGG - Intergenic
1034916322 7:155042833-155042855 AAGTCAGAGGTCTATAGGGTGGG - Intergenic
1035465385 7:159071841-159071863 GAGTCCCATGTCTCTAGGCTGGG + Intronic
1035465399 7:159071947-159071969 GAGTCCCATGTCTCTAGGCTGGG + Intronic
1035590874 8:812163-812185 GAGTCTGAAATCTGCAGGGTGGG + Intergenic
1037691195 8:21183107-21183129 GAGCCTGAAGCTTCTAGGATTGG - Intergenic
1037798223 8:22014804-22014826 GAGTATGAAATCTATAGGGCAGG + Intergenic
1038749778 8:30284736-30284758 GAGGCGGAAGTCTCTAGGCTGGG - Intergenic
1039456158 8:37708527-37708549 GAGTTGGAAGTCTGTAGGGCAGG + Intergenic
1041048844 8:53913709-53913731 GCCTCTGAAGGCTCTAGGGGAGG - Intronic
1041527313 8:58821921-58821943 GAGTCTGTAGTCTCTGGGGCGGG - Intronic
1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG + Intergenic
1042155989 8:65844162-65844184 AAGTCTGAAATCTGTAGGGCAGG + Intergenic
1042166298 8:65949099-65949121 GAGTCTGAAGGGTCAAGGATGGG - Intergenic
1043040595 8:75257985-75258007 GAATCTGAAGTCTACAGGGCAGG + Intergenic
1043390068 8:79783851-79783873 GAGTCCCAAGTCCCTACGGTGGG + Intergenic
1046627083 8:116586459-116586481 AAGTCTGAAGTCTATAGGGCAGG + Intergenic
1048716758 8:137279763-137279785 TAGCCTGAAGTTTCCAGGGTAGG + Intergenic
1048805538 8:138237795-138237817 AAGTCTAAAGTCTACAGGGTAGG - Intronic
1048949888 8:139487637-139487659 AAGTCTGAAGTCTGCAGGGCAGG + Intergenic
1050657927 9:7849477-7849499 GAATCTAAGGTCTCCAGGGTAGG - Intronic
1052410841 9:28119234-28119256 GAGGCTGAGGTTTCTAGGTTGGG - Intronic
1056607757 9:88100731-88100753 AAGTCCAAAGTCTGTAGGGTAGG + Intergenic
1057346507 9:94256028-94256050 AAGTCTGAAATCTGTAGGGCAGG + Intergenic
1058841656 9:108915504-108915526 GAGTATGAAATCTGTAGGGCAGG - Intronic
1059612731 9:115916605-115916627 GAGTGTGAAGGCACTAGGGCTGG - Intergenic
1186023021 X:5277861-5277883 GAGTCTAAAGTCACCAGGATGGG - Intergenic
1186111143 X:6257200-6257222 AGGTCTGAAGTCACTGGGGTAGG + Intergenic
1186959234 X:14716927-14716949 TAGCCTGAAGTCTCCAGAGTTGG - Intronic
1187985116 X:24801993-24802015 AAGTCTGAAATCTGTAGGGCAGG + Intronic
1189203753 X:39220078-39220100 CCCTCTGAAGTCTCCAGGGTAGG + Intergenic
1192483372 X:71504159-71504181 GAGTCTGAAATCCGTAGGGTGGG - Intronic
1194143310 X:90232451-90232473 CTGTCTGAAGTCTCTGGGCTTGG - Intergenic
1198384376 X:136114611-136114633 GAATCTAAAGTCTCTACGATGGG - Intergenic
1199039330 X:143092857-143092879 GAGTCTGAAGTTTCTACTATGGG + Intergenic
1199610461 X:149608015-149608037 AAGTCTGAAATCTCCAGGGCAGG - Intronic
1199998431 X:153042587-153042609 AAGTCTGAAATCTGTAGAGTAGG + Intergenic
1200489063 Y:3801773-3801795 CTGTCTGAAGTCTCTGGGCTTGG - Intergenic
1201292419 Y:12433756-12433778 CCCTCTGAAGTCTCTAGGGAAGG + Intergenic
1201535004 Y:15037708-15037730 AAGCCTGAAGTGACTAGGGTGGG + Intergenic