ID: 1167149437

View in Genome Browser
Species Human (GRCh38)
Location 19:47700392-47700414
Sequence TGATTTACCCCCAGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167149433_1167149437 25 Left 1167149433 19:47700344-47700366 CCGTCTCAAAAAAAAAGAAAGGC 0: 3
1: 165
2: 2624
3: 19249
4: 123960
Right 1167149437 19:47700392-47700414 TGATTTACCCCCAGTGGGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 97
1167149434_1167149437 -7 Left 1167149434 19:47700376-47700398 CCTCAATGCTGTCTTCTGATTTA 0: 1
1: 0
2: 2
3: 33
4: 335
Right 1167149437 19:47700392-47700414 TGATTTACCCCCAGTGGGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167149437 Original CRISPR TGATTTACCCCCAGTGGGTT TGG Intronic
900476702 1:2879514-2879536 TGACTGGCCCCCACTGGGTTGGG + Intergenic
900537006 1:3183698-3183720 TGATTTTCCTCCAGCGGGTCAGG + Intronic
900637489 1:3673032-3673054 TGATTTGCCTCCAGTGGGCCAGG + Intronic
901746210 1:11375456-11375478 TGATTTACCCCTAGCTGGTCTGG + Intergenic
902103990 1:14018277-14018299 CAATTTACCCACAGTGGATTGGG - Intergenic
905285893 1:36880170-36880192 GGATTTACACCCAGGTGGTTTGG + Intronic
907142820 1:52204369-52204391 TGATATAACCCCAGCAGGTTAGG + Intronic
907626171 1:56032347-56032369 TGATCTAGGCCCAGTGGGATTGG - Intergenic
908945532 1:69491770-69491792 TGAGTTACACCAAGAGGGTTAGG + Intergenic
913135411 1:115883757-115883779 TGATTTACGCCCAGTGCTTCAGG - Intergenic
913677753 1:121157780-121157802 TGAATCACCCTCAGTGGGATGGG - Intergenic
914029587 1:143945409-143945431 TGAATCACCCTCAGTGGGATGGG - Intronic
914159862 1:145122541-145122563 TGAATCACCCTCAGTGGGATGGG + Intergenic
919802509 1:201362086-201362108 TGCTCCACCCCCAGGGGGTTTGG - Intronic
920465059 1:206176290-206176312 TGAATCACCCTCAGTGGGATGGG - Intergenic
921430310 1:215057840-215057862 TGATTAACCCCCTTTGGGCTTGG - Intronic
922655518 1:227379213-227379235 TGATTAAACCCCAGGAGGTTAGG - Intergenic
924350312 1:243108256-243108278 TGATTCACCCTCACTGGATTTGG - Intergenic
1070715540 10:78718373-78718395 TTATTTACCCTCTGTGGGTTAGG + Intergenic
1071958734 10:90787167-90787189 TGATGTATCCCCAGTGTGTCTGG - Intronic
1082246751 11:49932288-49932310 TCATTTACTCCAAGTAGGTTAGG - Intergenic
1082789542 11:57337990-57338012 TGAGTTGCCCCCAGTGGCATGGG - Intergenic
1091892333 12:4069451-4069473 TGATAAAACCCCAGTGTGTTTGG + Intergenic
1093763173 12:22933245-22933267 TGCTTTCCCCACAGTGGGTAAGG - Intergenic
1093919005 12:24838131-24838153 TGATGTAACCCCAGTGGAGTGGG - Intronic
1094053981 12:26249827-26249849 GGATTTACCCCTAGAGGCTTTGG + Intronic
1095254775 12:40022091-40022113 TGATTTACCTCCAGTTCCTTGGG - Intronic
1097325770 12:58275437-58275459 TGATTTATCACTAGTGGTTTAGG + Intergenic
1097497966 12:60366128-60366150 TGATATAATCCCAGTAGGTTAGG - Intergenic
1099018410 12:77373445-77373467 TGTTTTTCCCCTAGTGGATTGGG - Intergenic
1103038271 12:117673909-117673931 TGATATAGCCCCAGAGGATTTGG - Intronic
1110751970 13:79125028-79125050 TAAATTACACCCAGTGGGCTGGG - Intergenic
1115507539 14:34106885-34106907 AGATTTTCCCCCTCTGGGTTTGG + Intronic
1120117338 14:80635383-80635405 TTTTTTACCCCCAGTGGAGTTGG - Intronic
1120865271 14:89291064-89291086 TGATTTACACCGTGTGGATTGGG - Intronic
1122650830 14:103225986-103226008 TTATTTTCTCCCAGTGGGCTTGG + Intergenic
1129874705 15:78966073-78966095 TTCTGTACCCCCAGTGGCTTAGG + Intronic
1130330794 15:82920821-82920843 TGTTTTACCCCCAGAGTGGTAGG - Intronic
1136638711 16:31543350-31543372 TCATCTAACCCCACTGGGTTAGG + Intergenic
1140716245 16:77728142-77728164 AGATTTCCCCCCAGTGGATGGGG + Intronic
1203124749 16_KI270728v1_random:1563761-1563783 TGATTTACTCTCATTGGATTTGG + Intergenic
1146481683 17:33210057-33210079 TAAATGACCCCCAGTGGGTGGGG - Intronic
1149781468 17:59399850-59399872 TCATTCACCCCAGGTGGGTTGGG + Exonic
1155690806 18:28620348-28620370 TGATATAGCCCCAGTAGGTTAGG - Intergenic
1158328602 18:56337356-56337378 TGAGTTTCCCACAGTGTGTTGGG - Intergenic
1159084787 18:63776312-63776334 TTAGTTACCCCTAGTGGGTGGGG - Intronic
1162201321 19:9022641-9022663 TGATTTAAACCCAGTGTGTCTGG - Intergenic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
1167149437 19:47700392-47700414 TGATTTACCCCCAGTGGGTTTGG + Intronic
930805245 2:55483813-55483835 TGTTTGACCCCCAGTGGTTCTGG + Intergenic
931014971 2:57966244-57966266 TGATTTGCGCACAGTGGGTTGGG + Intronic
931496807 2:62816758-62816780 TGATTTGCCCACAGTGCTTTTGG + Intronic
935309381 2:101768267-101768289 TTAATTAACCCCAGTGGGCTTGG + Intronic
936773027 2:115937915-115937937 TAATTTACCAACAGTGGTTTAGG + Intergenic
944400224 2:199317369-199317391 TGATTTCTCCCCAGCTGGTTAGG - Intronic
945010187 2:205452864-205452886 CCATTTACCCCCAGTGGTTGAGG - Intronic
945288045 2:208101906-208101928 TGAGTTAGCCCCAGTGGGTGTGG - Intergenic
946173478 2:217908979-217909001 TGACTTACCCTGAGTGGGTTAGG - Intronic
1169398337 20:5256355-5256377 TGATTTACCTATAGTGGCTTTGG - Intergenic
1177296801 21:19186511-19186533 TCATTTACCACCAGTTGGTGGGG - Intergenic
1179193526 21:39143580-39143602 TAAGTTACCCCCAGGAGGTTAGG - Intergenic
1179213418 21:39346910-39346932 AGTTTTACTCTCAGTGGGTTTGG - Intronic
1183952123 22:41357843-41357865 TGATTTGCCCCCAGGGGGAGGGG - Exonic
952226433 3:31381504-31381526 TATTTTACCCCCACTTGGTTTGG - Intergenic
958744505 3:98116021-98116043 TGATTTAGCCCTAGGGGGATGGG + Intergenic
958907727 3:99960439-99960461 TGATTTTTCCCCTGTGGGTAGGG - Intronic
959321070 3:104876646-104876668 TAATTTTCTCCCAGTGGGTTAGG + Intergenic
964275851 3:155008374-155008396 TGATTTACAGCAACTGGGTTTGG + Intergenic
967948453 3:194822526-194822548 TGCTTTCCCCCCAGGGGGCTAGG - Intergenic
969709794 4:8836140-8836162 AGAGTTACCCCCAGTGGTGTGGG - Intergenic
970358065 4:15277648-15277670 TGATAAAACCCCAGTAGGTTAGG - Intergenic
973174522 4:47188135-47188157 TGATTGCCACACAGTGGGTTTGG + Intronic
977111523 4:92962540-92962562 GAATTAACCCCCAGTAGGTTAGG + Intronic
979167994 4:117561068-117561090 TGATGTTCACCCAGTGGGATTGG - Intergenic
979251622 4:118572298-118572320 TGATTCACCCTCACTGGATTTGG + Intergenic
987236780 5:15950570-15950592 GCATTTACCCCCAGTGAGTAGGG + Intergenic
990258260 5:53994013-53994035 TCATTTACCCCCACTGGATTGGG - Intronic
995305325 5:110640014-110640036 TGATTCACCCCCCTCGGGTTGGG + Intronic
1007911012 6:45514066-45514088 TGCTTCAGCCACAGTGGGTTGGG - Intronic
1013183875 6:107740666-107740688 AGATTTACCCCCAGAGGCCTTGG + Intronic
1017716475 6:157217169-157217191 TGCAAAACCCCCAGTGGGTTCGG - Intergenic
1018885691 6:167934315-167934337 TAAGTTACCCCCAGCAGGTTTGG - Intronic
1019831665 7:3336546-3336568 TCATTTGCCACCAGTGGGTGTGG - Intronic
1021468342 7:20971327-20971349 TGAGTTCCTCCCAGTGTGTTGGG + Intergenic
1021591206 7:22264717-22264739 TGATTTACACAGAGTGGGATTGG - Intronic
1024447005 7:49492439-49492461 TAATCAACCCCAAGTGGGTTAGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1031018301 7:116598826-116598848 TGTTTCACTCCCAGTCGGTTTGG + Intergenic
1039150009 8:34493937-34493959 TCATTTACTCCCAGTCGGTATGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1043555015 8:81420824-81420846 TGATCTACTCCCTGTGGGTGTGG - Intergenic
1045272011 8:100670219-100670241 TGCTATACCCCCAGTGCCTTGGG + Intergenic
1045962185 8:107981023-107981045 TGATGTAACCCCAGTATGTTTGG - Intronic
1047672951 8:127169062-127169084 TGATAAAACCCTAGTGGGTTAGG + Intergenic
1051505279 9:17820282-17820304 TGATTTTCCCCCAATTGGTAAGG + Intergenic
1053630385 9:39931324-39931346 TGCTTTACTCCCCATGGGTTAGG + Intergenic
1053775382 9:41532184-41532206 TGCTTTACTCCCCATGGGTTAGG - Intergenic
1054213502 9:62319378-62319400 TGCTTTACTCCCCATGGGTTAGG - Intergenic
1054862918 9:69971705-69971727 TGATTTTCCGGCAGTGTGTTAGG - Intergenic
1055846612 9:80572432-80572454 TGATTTATCCTGAGTGAGTTTGG - Intergenic
1062358949 9:136178412-136178434 TGACTGAGCCCCGGTGGGTTGGG - Intergenic
1186224959 X:7388572-7388594 TGACTTACCCACATTGGCTTAGG + Intergenic
1187554886 X:20342152-20342174 TACTCTACTCCCAGTGGGTTGGG + Intergenic
1192970947 X:76229240-76229262 TAATTTACCCCCGATGGGTGTGG + Intergenic
1198050508 X:132948008-132948030 TGATTTACCTCAAATGGATTAGG - Intronic