ID: 1167149842

View in Genome Browser
Species Human (GRCh38)
Location 19:47702243-47702265
Sequence CAGGTTCAGGATGCTGTCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167149842_1167149845 -9 Left 1167149842 19:47702243-47702265 CCATCGACAGCATCCTGAACCTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1167149845 19:47702257-47702279 CTGAACCTGCAGCAGGCCCCCGG 0: 1
1: 0
2: 1
3: 29
4: 345
1167149842_1167149846 -5 Left 1167149842 19:47702243-47702265 CCATCGACAGCATCCTGAACCTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1167149846 19:47702261-47702283 ACCTGCAGCAGGCCCCCGGCCGG 0: 1
1: 1
2: 2
3: 20
4: 260
1167149842_1167149857 29 Left 1167149842 19:47702243-47702265 CCATCGACAGCATCCTGAACCTG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1167149857 19:47702295-47702317 CTCGTACCCCCACGCTGCCTCGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167149842 Original CRISPR CAGGTTCAGGATGCTGTCGA TGG (reversed) Exonic
900264125 1:1748949-1748971 CAGGTCCTGGATGATGTAGAAGG + Intergenic
901480492 1:9521595-9521617 CAGGTTCAGGTGGCTGAGGAAGG - Intergenic
905822346 1:41003439-41003461 CAGCTTCAGGATGGTGGCCACGG - Intronic
909235520 1:73148420-73148442 CATGTTCAGGCTACTGTCCAGGG - Intergenic
909944174 1:81644758-81644780 CTGGTTCAGGATGCTAACAATGG + Intronic
913975206 1:143450257-143450279 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914069599 1:144275873-144275895 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914109556 1:144690481-144690503 CAGGTTCAGGATGGAGGCGGTGG - Intergenic
916115332 1:161480873-161480895 CAGGACCAGGAGGCTGTCAAGGG - Intergenic
919122007 1:193353142-193353164 GAGGTTCAGGATGAAGTGGAAGG + Intergenic
919737672 1:200963430-200963452 CAGTTTCAGGAAGCAGTCAAGGG + Intergenic
922683062 1:227616936-227616958 CAGGTCCAGGCTGCTGTACAAGG + Intronic
924426300 1:243953153-243953175 CAAGTTCAGGAAGCAGGCGAGGG + Intergenic
924605477 1:245530986-245531008 GAGGTTCAGGAGGCAGTAGAAGG + Intronic
1068072015 10:52207302-52207324 CAGGTTCAGTCTGCTGGTGAGGG + Intronic
1076311665 10:129512078-129512100 CAGATGCAGGATGCTGGAGATGG + Intronic
1082064645 11:47890072-47890094 CTGGTTCAGGATGATGCCAATGG - Intergenic
1083162678 11:60864974-60864996 CAGGCTGAGGGTGCTGGCGAGGG - Intergenic
1083338826 11:61945629-61945651 CAGGGCCTGGATGCTGTCAAAGG - Intergenic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1084508646 11:69587511-69587533 CAGGGTGATGATGCTGTTGAAGG - Intergenic
1084608104 11:70184239-70184261 CAGATTCAGGGAGCTGTGGAGGG + Intronic
1085692637 11:78676218-78676240 CAGGTTGAGGCCGTTGTCGATGG + Exonic
1086835193 11:91612523-91612545 CATGTTCAGAATGCAGTCAACGG - Intergenic
1089398673 11:118152283-118152305 GAGGTTCAGGATGCTGGAGGAGG - Intronic
1089441766 11:118523482-118523504 CAGGTTCAGGACTCTGTCTTGGG - Exonic
1091327614 11:134703009-134703031 CAGGCTCAGGCTGCTGAGGAAGG + Intergenic
1092261410 12:6955182-6955204 CAGGTCCGTGAGGCTGTCGAAGG - Exonic
1094549079 12:31433181-31433203 CATGCTCAGAATGCTGGCGAAGG + Exonic
1094830541 12:34298176-34298198 GAGGTTATGGCTGCTGTCGAAGG + Intergenic
1096584916 12:52613781-52613803 CAGGTTCCGGTTGTTGTCCATGG + Exonic
1101079769 12:101171019-101171041 CAGGAGCAGGATGGTGTCGTGGG + Intronic
1101456733 12:104840044-104840066 CAGGTTTATTATGCTGTCAAGGG + Intronic
1101870882 12:108564185-108564207 CAGGTTCAAGATGCTGACCGAGG + Intronic
1102035469 12:109768522-109768544 CTGGTACAGGAGGCTGTGGATGG - Exonic
1102754593 12:115327098-115327120 CAGGTTCAGGATGGGGACCAAGG + Intergenic
1103881144 12:124166891-124166913 GAGGTCCAGGCTGCTGTCCAGGG - Intronic
1105297453 13:19101438-19101460 GGGGTTCAGGATGGTGTCTATGG - Intergenic
1105299117 13:19117359-19117381 CAGGTTAGGGGTGCTGTCGGGGG - Intergenic
1111433087 13:88169086-88169108 CAGTTTCAGGATGGTATAGAAGG - Intergenic
1115296128 14:31829118-31829140 AAGGTCCAGGATGCTGTCATGGG + Intronic
1115951941 14:38731204-38731226 CAGGTTTAGGAAGCTGTCACTGG + Intergenic
1120593470 14:86404677-86404699 CAGGTTCAGTAGACTGCCGAAGG + Intergenic
1122029322 14:98901123-98901145 CAGATTCAGGAGGCTGGCGTTGG - Intergenic
1123505974 15:20941577-20941599 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1123563206 15:21515284-21515306 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1123599455 15:21952567-21952589 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1127815434 15:62604610-62604632 CAGGTTCAGGAGGGTGTTGGTGG + Intronic
1128676362 15:69611967-69611989 CAGGTTCAGGATGCTGCCTTAGG - Intergenic
1128907209 15:71477783-71477805 CAGGTTCAGCATGGTGAAGAGGG - Intronic
1129299959 15:74619802-74619824 CAGCTGGAGGATGCTGTCGTTGG + Intronic
1202971558 15_KI270727v1_random:242418-242440 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1132598216 16:762730-762752 CAGGAACAGGAGGCTGCCGAGGG - Exonic
1135675673 16:24412868-24412890 CATGTTCAGGATGATGGCCATGG + Intergenic
1141103533 16:81215104-81215126 CAGGTCCAGGATGCCGTCTACGG - Intergenic
1141609442 16:85172789-85172811 CAGGATCAGGAAGCTTTCAAAGG - Intronic
1145362172 17:22221453-22221475 CAGGTTCAGGCTCCTCTCCAGGG - Intergenic
1146385381 17:32367769-32367791 CAGGCTCAGGCAGCTGTCCAAGG + Exonic
1149475720 17:56959698-56959720 CAGGTGCAGGAAGCTGACAAAGG - Intronic
1150699301 17:67433747-67433769 CAGGCTCAGGAGGCTGACGCAGG + Intronic
1151237860 17:72734537-72734559 CAGTTAGAGGATCCTGTCGAGGG + Intronic
1151981166 17:77510085-77510107 CAGTTTCAGGATGTTGTTGATGG - Intergenic
1152754259 17:82080562-82080584 CAGGCTGTGGATGCTGTCAAGGG + Exonic
1154269056 18:12903581-12903603 GAGCTTCAGGATGCTGAAGAGGG - Intronic
1160020931 18:75180705-75180727 CAGGCTCAGGGTGCAGTGGAGGG - Intergenic
1160104891 18:75964844-75964866 CTGGTTCAGGATGCTTGCAAGGG - Intergenic
1160502940 18:79411234-79411256 CAGGTCCAGGCTGCTGTCGGTGG - Exonic
1160662612 19:308181-308203 CAGGTGCAAGATCCTGGCGACGG + Intronic
1161055694 19:2189773-2189795 CAGCTGGTGGATGCTGTCGATGG - Exonic
1163250850 19:16125507-16125529 CCAGTTCCGGATGTTGTCGAAGG - Exonic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
1168057998 19:53874182-53874204 CAGGTTCAGCAGGATGGCGATGG - Exonic
927256671 2:21045458-21045480 CAGGTGCAGGAAGCAGGCGAAGG - Intergenic
927930303 2:27039587-27039609 CAGCTCCAGGCTGCTGTGGAGGG - Intronic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
932354637 2:71058799-71058821 CAGATGCAGGATGCTGGGGAGGG + Intergenic
934179906 2:89611230-89611252 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
934290202 2:91685491-91685513 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
934557392 2:95294675-95294697 AAGGTTAAGGAGGCTGTGGAAGG - Intergenic
939173821 2:138726715-138726737 GAGGTGCAGGATGCTGACAATGG - Intronic
941936410 2:170984673-170984695 CACGTTCATGATGCAGTCTAGGG + Intergenic
944842195 2:203635122-203635144 CAGGCTCAGGCAGCTGTCCAAGG - Intergenic
946182676 2:217958386-217958408 CATGCTCAGGATGCAGACGACGG - Intronic
947534675 2:230933325-230933347 CAGGTGGAGGATGCGGTGGACGG - Intronic
948947844 2:241230165-241230187 CAGATTGAGGATGTGGTCGATGG + Exonic
1173986039 20:47262295-47262317 AAGATTCAGGATGCTGCCGGTGG + Exonic
1180157944 21:45987047-45987069 CATGTCCACGATGGTGTCGATGG - Exonic
1182631071 22:31685863-31685885 CAGGGTCAGGATGTTGACGCTGG + Intronic
1183092431 22:35531943-35531965 CAGGTGCAGGCTGCTGATGATGG - Intergenic
962871127 3:139493992-139494014 CAGGGTCAGGATGCTGTGCTTGG - Intergenic
963141761 3:141951733-141951755 CAGATTTAGGATGCTGGCAAAGG + Exonic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
979381500 4:120011758-120011780 CAGGTTCAGGCTGATGGTGATGG + Intergenic
979913537 4:126402303-126402325 CAGGTACAGGATGTTTTTGAGGG + Intergenic
980869286 4:138592928-138592950 CTGGTTCAAGATGCTGGCAATGG - Intergenic
992101562 5:73412564-73412586 CAGTATCAGAATGCTGTCTATGG - Intergenic
994917118 5:105994735-105994757 CTGTTTCAGGATGCTGGGGAAGG - Intergenic
995550697 5:113278210-113278232 CAGGTTAAGGATCTTGTCCAAGG - Intronic
1000393385 5:160748229-160748251 CAGTTTCAAGATGCTGGGGAGGG - Intronic
1002101745 5:176861330-176861352 CAGGTTCAGGATGGGGTGGATGG + Intronic
1002888201 6:1313519-1313541 CTTGCGCAGGATGCTGTCGATGG - Exonic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1010098217 6:72072115-72072137 CTGGGTCAGGATGATGTTGAAGG + Intronic
1010865216 6:80967939-80967961 CAGGCTCATGATGCTGGTGATGG - Intergenic
1010987162 6:82438074-82438096 CAAGTTCAGAATGCTGTGAAAGG + Intergenic
1017889278 6:158625517-158625539 CAGGGCCAGGATGGTGTCCAGGG - Intronic
1018942513 6:168319097-168319119 CAGCTTCGGGATGCTGGCGTGGG + Intronic
1019170012 6:170128602-170128624 CAGGTGGAGGATGCTGTAGGTGG + Intergenic
1022390701 7:29941800-29941822 CAGCTTCAAGATGCTGTCTAGGG + Intronic
1024210522 7:47199408-47199430 CAGGTTCAGCCTTCTGGCGAGGG + Intergenic
1025715460 7:63951768-63951790 CAGGTTCAAGAGGCTGAGGAAGG + Intergenic
1025995022 7:66522575-66522597 CAGGTTGAAGATGCCCTCGAAGG - Intergenic
1027052165 7:75027406-75027428 CAGGGTGAGGCTGCTGGCGAGGG - Intronic
1028934982 7:96454870-96454892 CAGGTCCAGGCTGCTGTGCAAGG + Intergenic
1029842455 7:103380512-103380534 CAGTTTCAGGAAGCTTTCCAAGG + Exonic
1038730937 8:30127208-30127230 CAAGCTCAGGATGCTGGCAAAGG - Intronic
1041101110 8:54397191-54397213 CAGGTGCAGGGTGTTGACGATGG - Intergenic
1041933792 8:63314963-63314985 CAGGTTCAGGCTGCTGTTGCTGG + Intergenic
1043664668 8:82793772-82793794 GAGGTCCAGGATGCTGTGTAAGG + Intergenic
1049929376 9:441395-441417 CTTGTTAACGATGCTGTCGAAGG - Exonic
1061860807 9:133467935-133467957 CAGGGTCAGGCTGATGACGATGG - Exonic
1062200711 9:135301328-135301350 CAGGTGCAGGAGGCGGTGGAGGG - Intergenic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1062564557 9:137158456-137158478 CAGGTTCATGATGCTGTAGTTGG - Exonic
1186706662 X:12146877-12146899 CATCTTCAGTATGCTATCGAAGG + Intronic
1187176179 X:16898123-16898145 CAGGTGGAACATGCTGTCGATGG + Intergenic
1196915551 X:120531380-120531402 CAGTTTCAGGATGCTGCAGTTGG + Intronic