ID: 1167150088

View in Genome Browser
Species Human (GRCh38)
Location 19:47703376-47703398
Sequence AACGGGGCCTGGTACTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167150088_1167150098 7 Left 1167150088 19:47703376-47703398 CCTGCTGAGTACCAGGCCCCGTT 0: 1
1: 0
2: 4
3: 33
4: 278
Right 1167150098 19:47703406-47703428 CAGGGGGTTCAACATGAACAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1167150088_1167150093 -10 Left 1167150088 19:47703376-47703398 CCTGCTGAGTACCAGGCCCCGTT 0: 1
1: 0
2: 4
3: 33
4: 278
Right 1167150093 19:47703389-47703411 AGGCCCCGTTCTAGGCTCAGGGG 0: 2
1: 0
2: 4
3: 58
4: 364
1167150088_1167150094 -9 Left 1167150088 19:47703376-47703398 CCTGCTGAGTACCAGGCCCCGTT 0: 1
1: 0
2: 4
3: 33
4: 278
Right 1167150094 19:47703390-47703412 GGCCCCGTTCTAGGCTCAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167150088 Original CRISPR AACGGGGCCTGGTACTCAGC AGG (reversed) Intergenic
900321863 1:2088436-2088458 AATGGTGCCTGGGACCCAGCAGG + Intronic
900376968 1:2359279-2359301 CACAGGGCCTGGCACACAGCTGG + Intronic
901377897 1:8852892-8852914 AAAGGTGCCTGGTACACAGCAGG - Intergenic
902454334 1:16521155-16521177 AGCAGGGTCTGGTACTCACCAGG + Intergenic
903169990 1:21546806-21546828 GATGGGGCCTGGTACACAGTTGG + Intronic
903289249 1:22297419-22297441 ACCTGGGCCTGGCACTCAGGGGG + Intergenic
904494855 1:30880748-30880770 AACGGAGCCTGGGAGGCAGCAGG + Intronic
905284955 1:36873191-36873213 CACAGGGCCTGGCACTCAGGTGG + Intronic
905300208 1:36981789-36981811 AACAGTGCCTGGTACACAGTAGG - Intronic
905730872 1:40298762-40298784 AACAGTGCCTGGCACACAGCAGG - Intergenic
905923283 1:41732962-41732984 CCCTGGGCCTGGTACACAGCAGG + Intronic
905937681 1:41837775-41837797 AACAGTGCCTGGTACCCAGTAGG + Intronic
906512831 1:46420856-46420878 CATGGTGCCTGGTACTCAGTGGG + Intergenic
906708948 1:47915104-47915126 AACAGGGCCTGGCACACAGTAGG + Intronic
906808741 1:48805077-48805099 ATGGGGGTCTGGTACCCAGCAGG - Intronic
913585683 1:120273191-120273213 AACGGTGCCTGATACATAGCTGG - Intergenic
914038568 1:144026696-144026718 ATCGGTGCCTGGCACTTAGCAGG - Intergenic
914150887 1:145041211-145041233 ATCGGTGCCTGGCACTTAGCAGG + Intronic
914567690 1:148885050-148885072 AACGGTGCCTGATACATAGCTGG - Intronic
914605132 1:149245195-149245217 AACGGTGCCTGATACATAGCTGG + Intergenic
915625586 1:157112161-157112183 AACTGGGCCTGGGACTCACAGGG - Intergenic
915626377 1:157116421-157116443 AACTGGGCCTGGCATCCAGCAGG + Intergenic
916074225 1:161191086-161191108 ACCGGGGCCTCGGACTTAGCTGG - Exonic
916418297 1:164612664-164612686 AAAGGTGCCTGGCACTCAGCTGG + Intronic
917121225 1:171646173-171646195 AAAGGGGCCTGGACCTAAGCCGG + Intronic
920137096 1:203778731-203778753 CATGGGGCCTGGCACTCAGAAGG + Intergenic
920474039 1:206257609-206257631 ATCGGTGCCTGGCACTTAGCAGG - Intronic
922221144 1:223609545-223609567 AACAGGGCCTGGCACCCAGAAGG - Intronic
922226416 1:223649809-223649831 CACGGTGCCTGGTACCTAGCAGG - Intronic
1067753361 10:48986050-48986072 AGCTGGGCCTGGTGCTCAGGTGG - Intergenic
1067755377 10:49000800-49000822 CACGAGGCCTGGAAGTCAGCAGG + Intergenic
1069536931 10:69260682-69260704 AAAGGGGCCTTGTACTGACCAGG - Intronic
1069782544 10:70965858-70965880 AACAGGGCCTGGTACACAGCAGG - Intergenic
1070491677 10:76982418-76982440 CACAGGGCCTGGCACTCAGGGGG + Intronic
1072108163 10:92292813-92292835 AACAGAGCCTGGTACTCAGTAGG + Intronic
1072739122 10:97899155-97899177 ATCTGGGACTGGCACTCAGCTGG - Intronic
1073057932 10:100714020-100714042 AGCAGGGCCTGGGACTCCGCTGG + Intergenic
1074121011 10:110494633-110494655 AACGGGGCCCCGTACTTAGAAGG - Intergenic
1076772575 10:132674468-132674490 ACCGGGGCCTGGTTCACAGATGG - Intronic
1076989798 11:267149-267171 AACAGGGCCTGGCACCCAGTGGG - Intergenic
1076995489 11:295607-295629 CAGGGGGCCTGGTCCTCATCAGG - Exonic
1077223150 11:1426191-1426213 ATGGGGGCCTGGCACACAGCGGG + Intronic
1077245419 11:1534656-1534678 AGCTGGGCCTGTTCCTCAGCCGG - Intergenic
1077418990 11:2440705-2440727 AACAGCGCCTGGCACTCAGCCGG + Intergenic
1077530914 11:3094374-3094396 AGCAGGGCCTGGGGCTCAGCAGG - Intronic
1078563840 11:12396602-12396624 AACAGGGCCTGGCCCTCAGTGGG + Intronic
1079006836 11:16797429-16797451 TACAGGGCCTGGCACTTAGCAGG + Intronic
1079110926 11:17604716-17604738 AACAGGGCCTGGCCCACAGCAGG + Intronic
1083180111 11:60979802-60979824 CACAGGGCCTGGTACTCAGCAGG - Intronic
1083274415 11:61588577-61588599 AACAGAGCCTGCTCCTCAGCTGG + Intergenic
1085146888 11:74208380-74208402 TACGATGCCTGGTACACAGCAGG - Intronic
1085335588 11:75691571-75691593 AACAGTGCCTGGTACACAGTAGG - Intergenic
1085532123 11:77198127-77198149 CACAGGGCCTGGCACACAGCAGG - Intronic
1086424520 11:86671303-86671325 AACAGTGCCTGGTACCCAGTGGG - Intronic
1086584152 11:88432607-88432629 AATAGGGCATGGTACACAGCTGG - Intergenic
1087062947 11:94000011-94000033 CACAGTGCCTGGTACACAGCAGG - Intergenic
1088326007 11:108602288-108602310 AACAGTGCCTGGCACACAGCAGG - Intergenic
1091881092 12:3978793-3978815 AACAGTGCCTGGTACATAGCAGG + Intergenic
1093084130 12:14847893-14847915 AACGGGGCCTAGCAGTCAGGAGG + Intronic
1094154903 12:27329285-27329307 AACAGTGCCTGGCACACAGCAGG + Intergenic
1094237920 12:28190209-28190231 AACAGGGCCTGCTACTCAAGAGG + Intronic
1096153225 12:49327653-49327675 AACAGAGCCTGGCACTCAGTAGG - Intronic
1096228239 12:49882798-49882820 AACAGGGCCTGGTACATAGTAGG - Intronic
1098260140 12:68661369-68661391 AACTGGGCCTGGTACATAGCTGG - Exonic
1098375813 12:69812651-69812673 AACGGTGCCTGGTACACAGTAGG + Intronic
1102526500 12:113515831-113515853 AACGGGGCCTAGTACACAGTAGG - Intergenic
1103105437 12:118220300-118220322 AACAGTACCTGGTACACAGCAGG + Intronic
1103557184 12:121773687-121773709 CTCGGGGCCTGGTATGCAGCTGG - Intronic
1103930457 12:124448107-124448129 AACGGGACCTGACACACAGCAGG + Intronic
1104275485 12:127323223-127323245 AACCTGGCCTGGCACTCAGTAGG - Intergenic
1106300835 13:28463332-28463354 AACAGCGCCTGTTACACAGCAGG + Intronic
1106364667 13:29067009-29067031 AAAGGGGCCAGTTACTCAGTAGG + Intronic
1107707488 13:43122220-43122242 CACAGGGCCTGGCACTCAGTGGG - Intergenic
1112346667 13:98595900-98595922 TATGGGACCTGGTACACAGCAGG - Intergenic
1113890441 13:113732559-113732581 AACGGAGGCTGCTTCTCAGCTGG + Intronic
1119032044 14:71200392-71200414 AACAAGGCCTGGTGGTCAGCGGG + Intergenic
1121248459 14:92482082-92482104 CACGGGGCCTGGCACACAGCAGG - Intronic
1122124732 14:99572825-99572847 AACGGGGCCTGGTGTGCAACAGG + Intronic
1122406082 14:101501923-101501945 CACAGGGCCTGGCACTCAGCTGG + Intergenic
1124407915 15:29408194-29408216 AACAGTGCCTGGTAAACAGCTGG - Intronic
1125109855 15:36019750-36019772 AATGGGGCCTGATATACAGCTGG + Intergenic
1125436406 15:39649912-39649934 CACGAGGCCTGACACTCAGCTGG - Intronic
1125472274 15:40015877-40015899 CACAGTCCCTGGTACTCAGCTGG - Intronic
1126114889 15:45199357-45199379 AACCGGGCCGAGTACACAGCAGG + Intronic
1126194548 15:45917681-45917703 CTGGGGGCCTGGCACTCAGCTGG + Intergenic
1128766791 15:70255978-70256000 AACAGTGCCTGATACACAGCAGG - Intergenic
1129659897 15:77547725-77547747 AGCAGGGCCTGGTACGCAGTAGG - Intergenic
1129761108 15:78129903-78129925 TACTGTGCCTGGTACACAGCAGG + Intronic
1129867147 15:78917918-78917940 TACAGAGCCTGGTACACAGCAGG - Intergenic
1132073220 15:98798071-98798093 AACAGTGCCTGGCACACAGCAGG - Intronic
1133295112 16:4747863-4747885 AAAGGGGCCTGGTCCTCTGAGGG + Intronic
1133845293 16:9447908-9447930 AACGGAGCCTGGCACAAAGCAGG - Intergenic
1134007608 16:10828544-10828566 CATGGGGCCAGGTACACAGCTGG + Intergenic
1135884213 16:26290675-26290697 AACAGTGCCTGGTACTTAGCAGG - Intergenic
1135953967 16:26940226-26940248 CACGGGGGCAGGCACTCAGCAGG + Intergenic
1136005176 16:27324450-27324472 CACGGTGCCTGGCACACAGCAGG - Intronic
1136174496 16:28507682-28507704 GACTGGGACTGGGACTCAGCAGG + Intronic
1136599592 16:31276029-31276051 AATAGTGCCTGGTACTCAGAAGG + Intronic
1137569349 16:49554872-49554894 CACAGTGCCTGGTACACAGCTGG + Intronic
1137598965 16:49743469-49743491 CATAGGGCCTGGTACACAGCAGG + Intronic
1138265152 16:55655308-55655330 AACAGTGCCTGGCACACAGCGGG + Intergenic
1138431306 16:56970953-56970975 AACGGTGCCTGGTACACACTAGG + Intronic
1138533926 16:57649738-57649760 AACTGAGACTGGAACTCAGCTGG + Intronic
1138557002 16:57776654-57776676 AACAGTGCCTGGTACACAGTAGG + Intronic
1138582209 16:57949034-57949056 AACAGTGCCTGGTACACAGTGGG - Intronic
1138822534 16:60278958-60278980 CACAGGGCCTGGCACACAGCAGG + Intergenic
1139204500 16:65014005-65014027 AACATGGCCTGGTCCACAGCAGG + Intronic
1139317327 16:66084658-66084680 CATAGGGCCTGGTACTTAGCAGG - Intergenic
1140664296 16:77213606-77213628 AACAGTGCCTGGTACCCAGCAGG - Intergenic
1141173650 16:81705745-81705767 AATGGTGCCTGGTCCACAGCAGG - Intronic
1141626255 16:85262896-85262918 AACGGGGCCTGGCATACAGTCGG - Intergenic
1142065202 16:88058412-88058434 AATGGGGCTTGGTCCGCAGCAGG + Intronic
1143452645 17:7044724-7044746 AACGGTGCCTGGTACACTGCAGG - Intergenic
1143675319 17:8428221-8428243 AACAGTGCCTGGTCCTCAGCAGG + Intronic
1144181175 17:12753890-12753912 AACGGGGCCTGGCACATAGTAGG - Intronic
1144656710 17:17042004-17042026 GAGGGGGCCTGGTACACAGTAGG + Intergenic
1146439709 17:32883191-32883213 AACTGTGCCTGGTACCCAACAGG + Intergenic
1147305110 17:39558000-39558022 AACAGTGCCTGATACTCAGTAGG + Intronic
1148969327 17:51465502-51465524 AACGGAGGCTGGAACTTAGCAGG + Intergenic
1150769823 17:68031529-68031551 AAAGGGGCCTGGAGCTGAGCTGG - Intergenic
1151347575 17:73511576-73511598 CCCAGGGCCTGGTACCCAGCAGG - Intronic
1151591281 17:75046695-75046717 AGCGGCGCCTGGGACACAGCCGG + Intronic
1151598709 17:75093551-75093573 AATGGAGCCTGGTGGTCAGCAGG - Intronic
1152386433 17:79977511-79977533 CACAGGGCCTGGCACGCAGCAGG + Intronic
1152873128 17:82769513-82769535 AACGGTGCCAGGCACACAGCAGG - Intronic
1155174557 18:23291036-23291058 AACAGAGCCTGGCACTCAGTAGG + Intronic
1157223758 18:45845163-45845185 AACGGTGCCAGGTAATCAGCTGG + Intergenic
1158379601 18:56914422-56914444 AATAGGGCCTGGTACACAGCAGG + Intronic
1159403286 18:67965336-67965358 AAGAGGGCCTGGTTCACAGCTGG - Intergenic
1159585078 18:70276405-70276427 AAAGTGGGCTGGTACTCAGTGGG - Intergenic
1160660067 19:293771-293793 AAGGGGGCCTGGCACACAGTAGG + Intergenic
1161210510 19:3062938-3062960 AGCGGGGCCTGGCACACAGTAGG - Exonic
1161262588 19:3346007-3346029 AACAGGGCCTGGCACACAGCAGG + Intergenic
1161396896 19:4049466-4049488 AACAGGGCCTGGCCCTCAGCGGG - Intronic
1161427491 19:4211705-4211727 AACGGTGCCTGGCATACAGCAGG + Intronic
1161427561 19:4212294-4212316 AATGGTGCCTGGTACACAGCAGG + Intronic
1161503984 19:4634180-4634202 AACAGGGCCTGGCACACAGTAGG - Intergenic
1162066864 19:8131270-8131292 CACAGTGCCTGGAACTCAGCTGG + Exonic
1162307972 19:9887074-9887096 AACAGTGCCTGGCACGCAGCAGG + Intronic
1162355969 19:10185033-10185055 AGCAGGGCCTGGCATTCAGCAGG - Intronic
1162549237 19:11349325-11349347 AACAGCACCTGGCACTCAGCAGG + Intronic
1162797990 19:13096423-13096445 AACGGTGCCTGCTACCCAGCTGG + Intronic
1163351782 19:16781137-16781159 AACAGGACCTGGTACTCAGCAGG - Intronic
1163574287 19:18101466-18101488 AACCGGGCTTGGTGCCCAGCAGG + Intronic
1164646044 19:29859235-29859257 AACTGGCCCTGGGACCCAGCAGG + Intergenic
1164712266 19:30365593-30365615 CACGGGACCTGGTGGTCAGCTGG - Intronic
1165012404 19:32858443-32858465 AACGGGACCTGCTTCACAGCGGG - Exonic
1165990966 19:39813446-39813468 CACAGGGCCTGGCACTCAGTAGG - Intergenic
1166007424 19:39917042-39917064 GACAGGGCCTGGTACGCAGCAGG + Intronic
1166067632 19:40369489-40369511 AACAGGGCCTGGCACACAGTAGG + Intronic
1166070850 19:40386745-40386767 AACAGGGCTTGGCACACAGCAGG + Intronic
1166137865 19:40788092-40788114 AGCAGGGCCTGGCACACAGCAGG - Intronic
1166375239 19:42324102-42324124 AGCGGGGCCAGGTACTCAAAGGG - Intronic
1166729318 19:45049748-45049770 AACAGGGCCTGGCCCACAGCAGG - Intronic
1166938760 19:46350497-46350519 AGAGGGGCCTGGCACTGAGCTGG + Intronic
1166965646 19:46528206-46528228 AGAGGGGCCTGGCACTGAGCTGG - Intronic
1167003235 19:46758047-46758069 AATGGTGCCTGGTACCCAGTAGG - Exonic
1167150088 19:47703376-47703398 AACGGGGCCTGGTACTCAGCAGG - Intergenic
1167487840 19:49773534-49773556 AACAGTGCCTGGCACCCAGCTGG - Intronic
1167496782 19:49824098-49824120 CACAGGGCCTGGTACACAGGAGG + Intronic
1168057039 19:53869654-53869676 AACGTGGCGTGGAACCCAGCAGG - Intronic
925286585 2:2720366-2720388 AACAGAGCCTGGTACACAGCAGG + Intergenic
927787471 2:25983292-25983314 AATGGGGCCTGGGGCTCAGCAGG - Intergenic
928467775 2:31538921-31538943 AACAGTGCCTGGGACACAGCAGG + Intronic
928854693 2:35789771-35789793 AATGGGGCATGGTACACAGATGG + Intergenic
928927870 2:36597484-36597506 AGCAGCGCCTGGCACTCAGCAGG + Intronic
930741489 2:54836695-54836717 CACAGGGCCTGGTACTCAGGAGG + Intronic
931537938 2:63299372-63299394 AACCAGGCCTGGTACACAGATGG - Intronic
933896792 2:86818285-86818307 AACAGTGCCTGGAACACAGCAGG - Intronic
935050472 2:99521034-99521056 CACAGGGCCGGGTACTCAGAAGG - Intergenic
935164927 2:100562248-100562270 AATGGTGCCTGGTACACAGCAGG + Intergenic
935336726 2:102023397-102023419 AACTGGGCCTGGAACTTGGCTGG - Intronic
936919158 2:117670106-117670128 CATGGTGCCTGGTACTCAGGAGG - Intergenic
937459521 2:122074035-122074057 CACAAGGCCTGGTACCCAGCAGG - Intergenic
941962420 2:171266807-171266829 CACAGGGCCTGGTACACAGTAGG + Intergenic
943487800 2:188509122-188509144 AACAGTGCCTGGTACACAGTAGG + Intronic
943846039 2:192649467-192649489 AACTGAGCCTGGAACTTAGCAGG + Intergenic
945990562 2:216392345-216392367 AACGGGGCATGTTTCCCAGCAGG + Intergenic
946408819 2:219506543-219506565 CACAGGGCCTGGCACACAGCAGG - Intronic
948453685 2:238094050-238094072 AGCGTAGCCTGGAACTCAGCAGG + Intronic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
1168765813 20:381159-381181 GACGGGGCGAGGTACTCGGCGGG + Exonic
1168932911 20:1638308-1638330 CACGGAGCCTGGTATGCAGCAGG + Intronic
1168963126 20:1882198-1882220 TTCAGGGCCTGGTACCCAGCAGG - Intergenic
1170451360 20:16487419-16487441 AACTGGGGCTGTTGCTCAGCAGG - Intronic
1171103653 20:22411014-22411036 AACAGGGCCTGGCACACAGAAGG + Intergenic
1171392509 20:24810837-24810859 CACTGCGCCTGGAACTCAGCTGG - Intergenic
1171422771 20:25029920-25029942 AACAGTGCCTGGTACACAGTTGG + Intronic
1172024463 20:31938466-31938488 CACAGGGCCTGGTACAGAGCAGG - Intronic
1172029707 20:31973324-31973346 AACAGTGCCTGGTATACAGCAGG - Intronic
1172038785 20:32029322-32029344 AATGGTGCCTGGTATACAGCAGG - Intronic
1172193691 20:33077666-33077688 AACAGGGCCTTGCACACAGCTGG - Intergenic
1173617402 20:44412136-44412158 AACAGGGCCTGGTTCACAGTAGG - Intronic
1173926598 20:46785622-46785644 AACGGGGCCTGGCACCTAGTAGG + Intergenic
1174102542 20:48138461-48138483 AACGTGGCCTGGGAGGCAGCTGG - Intergenic
1174113521 20:48212227-48212249 AAATGTGCCTGGTACACAGCAGG - Intergenic
1174285245 20:49468298-49468320 AGCCGTGCCTGGCACTCAGCAGG - Intronic
1174363325 20:50041787-50041809 AACGGTGCCTGGCACACAGTAGG - Intergenic
1174600996 20:51724696-51724718 CACAGGGCCTGGCACACAGCAGG + Intronic
1174829873 20:53802826-53802848 CACAGGGCCTGGTACCCAGGAGG - Intergenic
1175563758 20:59955557-59955579 CACGGGGCCTGGAACTCAGCTGG - Intergenic
1175582795 20:60113422-60113444 TACGTGACCTGGTGCTCAGCAGG + Intergenic
1175599450 20:60260905-60260927 GACAGGGCCTGGCACACAGCAGG + Intergenic
1175665095 20:60851982-60852004 AACCTGGGCTGGTATTCAGCCGG + Intergenic
1175727867 20:61331872-61331894 AACGGTGCCTGGCACACAGTAGG + Intronic
1175964357 20:62653051-62653073 GACGGTGCCTGGTACACAGCTGG + Intronic
1179148404 21:38789283-38789305 AACTGGGCCTGGCCCTTAGCAGG + Intergenic
1180724870 22:17939349-17939371 AACAGGGCCTGAGATTCAGCCGG + Intronic
1180926161 22:19556385-19556407 AACCATGCCTGGCACTCAGCAGG - Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183369337 22:37423629-37423651 AACCGGGCCTGGCTCTCAGTAGG + Intronic
1183648880 22:39142387-39142409 CTCTGGGCCTGGTACACAGCAGG + Intronic
1184597447 22:45522877-45522899 AACGGAGCCTGGCACCTAGCAGG - Intronic
950345558 3:12288591-12288613 AACGGGACCTCCTCCTCAGCAGG - Intronic
950371226 3:12532315-12532337 AACGGGGCCAGCTACTGAGAAGG - Intronic
950454919 3:13086955-13086977 AATGGGGCCTGGCACACAGCAGG + Intergenic
950568292 3:13784513-13784535 AACAGCGCCTGGCACACAGCTGG + Intergenic
953179706 3:40584131-40584153 CTCAGGGCCTGGTACTCTGCAGG + Intergenic
953642834 3:44725688-44725710 AACAGTGCCTGGTACTTAGGAGG + Intergenic
954369281 3:50161805-50161827 CACAGGGCCTGGTACACAGCAGG - Intronic
954662610 3:52234187-52234209 GAATGGGCCTGGTGCTCAGCTGG - Intronic
954744598 3:52780003-52780025 CACAGGGCCTGGTACTCAGTAGG - Intronic
955125239 3:56104766-56104788 AACAGTGCCTGGGACACAGCAGG - Intronic
955413277 3:58669750-58669772 AACAGTGCCTGGAACTCAGCAGG + Intergenic
955953977 3:64269158-64269180 CATGGGGCCTGGCACTGAGCTGG - Intronic
961931381 3:130537295-130537317 AAGTGGGTCTGGTACTCATCGGG + Intergenic
962663275 3:137626976-137626998 AACTGGGCCTGGGTCTCGGCAGG + Intergenic
968955923 4:3719366-3719388 AGCGGGGCCTGGCACCAAGCAGG + Intergenic
968981277 4:3850985-3851007 CATGGAGCCTGGTACACAGCTGG + Intergenic
969089636 4:4684241-4684263 CACAGGGCCTGGCACACAGCAGG - Intergenic
969162964 4:5277885-5277907 AACCTGGCCTGTCACTCAGCAGG + Intronic
969591766 4:8126272-8126294 CACGAGGCCTGGTGCCCAGCAGG - Intronic
969718743 4:8881445-8881467 AACGGGACCTGGTATCCATCTGG - Intergenic
970416838 4:15866324-15866346 AATGGTGCCTGGGACTCAGGAGG + Intergenic
971256625 4:25019939-25019961 AACAGTGCCTGGCACACAGCAGG + Intronic
971555833 4:28012540-28012562 AATGGGGCATGGTACACAGATGG - Intergenic
972231329 4:37075754-37075776 AAAGGGACCTGGTTCTCAGTGGG - Intergenic
978016406 4:103751881-103751903 AATGGGGCATGGTACACAGATGG + Intergenic
980071174 4:128244059-128244081 TACAGGGCCTGGTACCAAGCAGG - Intergenic
980076466 4:128298953-128298975 CACAGGGCCTGGCACCCAGCAGG - Intergenic
980801927 4:137762843-137762865 GATGAGTCCTGGTACTCAGCAGG - Intergenic
984835372 4:184014866-184014888 TACGGTGCCTGGTATACAGCAGG + Intronic
985535536 5:463452-463474 AACAGGACCTGCTGCTCAGCAGG + Intronic
985826817 5:2198165-2198187 AACAGGGCCTGGCACACAGTAGG + Intergenic
990895863 5:60699848-60699870 AACGGGGCCCAGAGCTCAGCCGG - Intronic
991719932 5:69485875-69485897 AACAGGGTCTGGTATACAGCAGG + Intergenic
992149386 5:73887882-73887904 AACCAGGGCTGGTACTCAGCTGG + Intronic
994584779 5:101693081-101693103 CACAGTGCCTGGTACCCAGCAGG + Intergenic
995342443 5:111074448-111074470 AACAGTGCCTGGTACACAACAGG + Intronic
997374216 5:133385164-133385186 GACTAGGCCTGGTACACAGCAGG + Intronic
997643694 5:135466438-135466460 GACAGACCCTGGTACTCAGCAGG - Intergenic
997725379 5:136116154-136116176 CACGGGGCTTGGTCCCCAGCAGG - Intergenic
998207114 5:140165866-140165888 GACTGGGCCTGGGACTGAGCAGG + Intergenic
1001386193 5:171341289-171341311 AACAGTGCCTGGTACACAGAAGG - Intergenic
1002296311 5:178233032-178233054 ACCCGGGCCTGGTACACAGTAGG + Intergenic
1002777765 6:343146-343168 AAGGTGGCTTGGTACACAGCAGG - Intronic
1002894622 6:1369628-1369650 AACTGGGCCTGGCACCCCGCAGG + Intergenic
1002913695 6:1511105-1511127 AACAGTGCCTGGTACACAGTAGG + Intergenic
1004963517 6:20820765-20820787 AACAGTGCCTGGTACACAGTAGG - Intronic
1006436445 6:34028101-34028123 AACGGGGCCAGGCACTCACCTGG + Exonic
1006709637 6:36056451-36056473 AATGGAGCCTGGCATTCAGCAGG - Intronic
1007257353 6:40538314-40538336 AAGGGGGGCTGCTACACAGCTGG - Intronic
1007305324 6:40899416-40899438 AACGGTGCCTGGCACACAGTAGG + Intergenic
1008012386 6:46482292-46482314 AAAGGGGACTGGTATTCAGATGG - Intronic
1010433386 6:75803569-75803591 AGCAGTGCCTGGTACTTAGCAGG + Intronic
1011534781 6:88364963-88364985 AACTGTGCCTGGTACATAGCAGG - Intergenic
1012212449 6:96538141-96538163 AACGGTGCCTGGCACACAGAAGG - Intronic
1013195383 6:107840508-107840530 AACAGTGCCTGGCACTCAGAAGG - Intergenic
1016940296 6:149477688-149477710 AACTGTGCCTGGTGCTCAGTGGG - Intronic
1018029542 6:159831218-159831240 AACAGTGCCTGGTACAGAGCAGG - Intergenic
1018403597 6:163452541-163452563 AACAGTGCCTGGAACACAGCTGG - Intronic
1019289211 7:242162-242184 CACAGGGCCTGGTACACTGCAGG - Intronic
1020278129 7:6636999-6637021 CGCGGGGCCTGGTCCTCAGCGGG + Intergenic
1020692937 7:11379914-11379936 CTCAGTGCCTGGTACTCAGCAGG + Intronic
1023997844 7:45172951-45172973 AATGGGACCTGGCACTGAGCAGG - Intronic
1026195677 7:68171432-68171454 TACAGGGCCTGGCACACAGCAGG - Intergenic
1027057518 7:75060273-75060295 AAAGGGGCCTATTCCTCAGCAGG - Intronic
1027135847 7:75623444-75623466 AATGGGGCCTGGTGCCCAGCAGG + Intronic
1033426630 7:141250684-141250706 CACGTGGCCAGGTGCTCAGCAGG - Intronic
1035105941 7:156441649-156441671 AGCAGGGCCTGGAATTCAGCAGG + Intergenic
1035450226 7:158973211-158973233 GAAGGCGCCTGGTAGTCAGCAGG + Intergenic
1035938159 8:3865661-3865683 AACAGTGCCTGGTACTTAACAGG - Intronic
1038035414 8:23682646-23682668 CGCGGGGCCCGGTGCTCAGCTGG + Exonic
1038563523 8:28600614-28600636 TACGAGGCCTGGTATACAGCAGG - Intronic
1040749055 8:50683138-50683160 AACAGCGCCTGGCACACAGCAGG + Intronic
1041121301 8:54589107-54589129 GACTGGGCCTGGCACACAGCAGG + Intergenic
1042310575 8:67375138-67375160 GATGGTGCCTGGTACTCTGCAGG + Intergenic
1045003652 8:97899282-97899304 CAAGGTGCCTGGTACACAGCAGG + Intronic
1045419075 8:101996100-101996122 CATGGTGCCTGGTACTAAGCAGG + Intronic
1045587679 8:103557539-103557561 AACAGTGCCTGGAACACAGCAGG - Intronic
1046516677 8:115271302-115271324 AACGGGTTCTGGTGCCCAGCTGG - Intergenic
1047518995 8:125580036-125580058 AACAGTGCCTGGCACACAGCAGG - Intergenic
1047979593 8:130166689-130166711 AACTGTGCCTGGCACACAGCAGG + Intronic
1049096347 8:140550488-140550510 TAGAGGGCCTGGTACTCACCTGG + Intronic
1049201174 8:141341381-141341403 CCCAGGGCCTGGCACTCAGCAGG - Intergenic
1049367745 8:142248892-142248914 CACAGGGCTGGGTACTCAGCAGG + Intronic
1049807633 8:144548115-144548137 ATGGGGGCCTGGTACTCCACTGG + Exonic
1051101102 9:13522597-13522619 CAAGGGGCCTGGTCTTCAGCTGG - Intergenic
1052248533 9:26368803-26368825 AACGGTGCCTGGTACATAGTAGG + Intergenic
1053138169 9:35664789-35664811 AACAGGGCCTGGCGCTCAGGTGG + Exonic
1053761191 9:41350861-41350883 AACGGGGCCTGATGCCCATCTGG - Intergenic
1056751960 9:89358290-89358312 ACCAGGCCCTGCTACTCAGCTGG - Intronic
1057931091 9:99193769-99193791 AACTGTGCCTGGTACACAGTAGG + Intergenic
1059338704 9:113585080-113585102 CGCAGGGCCTGGTACACAGCAGG - Intronic
1059390855 9:113998906-113998928 CACAGGGCCTGGTCCACAGCAGG - Intronic
1059393684 9:114017300-114017322 AAGCAGGCCTGGGACTCAGCTGG - Intronic
1059946615 9:119415065-119415087 CACAGGGTCTGGTACACAGCAGG - Intergenic
1060153085 9:121300961-121300983 CACGGGGCCTGGCAGACAGCAGG - Intronic
1060885352 9:127148513-127148535 CACGGTGCCTGGCACACAGCAGG - Intronic
1061213573 9:129207433-129207455 AACAGGGGCTGGTACGGAGCAGG - Intergenic
1062554542 9:137107995-137108017 AACAGGGCCTGGTCCACAGTGGG - Intronic
1186418388 X:9403292-9403314 ATTGGGCCCTGGTACTGAGCAGG + Intergenic
1188384919 X:29544662-29544684 AACAATGCCTGGTACTTAGCAGG + Intronic
1190257458 X:48774213-48774235 AACAGGGCCTGGCACACAGGTGG - Intergenic
1193288296 X:79739477-79739499 AACAGTGCCTGGTACTTAGTGGG - Intergenic
1197862742 X:130987834-130987856 AAAGGGGCTGGCTACTCAGCTGG + Intergenic