ID: 1167150933

View in Genome Browser
Species Human (GRCh38)
Location 19:47709220-47709242
Sequence GCCTATTAGTTCCCACGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167150933_1167150937 -6 Left 1167150933 19:47709220-47709242 CCCCAGCGTGGGAACTAATAGGC No data
Right 1167150937 19:47709237-47709259 ATAGGCCCAGCTTGCAGGTGAGG No data
1167150933_1167150941 24 Left 1167150933 19:47709220-47709242 CCCCAGCGTGGGAACTAATAGGC No data
Right 1167150941 19:47709267-47709289 GGCCCCAAAGATGTAGTACATGG No data
1167150933_1167150940 3 Left 1167150933 19:47709220-47709242 CCCCAGCGTGGGAACTAATAGGC No data
Right 1167150940 19:47709246-47709268 GCTTGCAGGTGAGGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167150933 Original CRISPR GCCTATTAGTTCCCACGCTG GGG (reversed) Intergenic
No off target data available for this crispr