ID: 1167152221

View in Genome Browser
Species Human (GRCh38)
Location 19:47716856-47716878
Sequence GAGGTGCCCGGCTCCCGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167152216_1167152221 -4 Left 1167152216 19:47716837-47716859 CCAGTACCTGCTGGAGCAGGAGG 0: 1
1: 0
2: 1
3: 47
4: 352
Right 1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1167152212_1167152221 26 Left 1167152212 19:47716807-47716829 CCAGTACAGCACGGGCAAGACCA 0: 1
1: 1
2: 0
3: 7
4: 116
Right 1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1167152213_1167152221 6 Left 1167152213 19:47716827-47716849 CCAGCTTCATCCAGTACCTGCTG 0: 1
1: 1
2: 1
3: 37
4: 276
Right 1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1167152211_1167152221 30 Left 1167152211 19:47716803-47716825 CCGGCCAGTACAGCACGGGCAAG 0: 1
1: 0
2: 2
3: 8
4: 78
Right 1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1167152218_1167152221 -10 Left 1167152218 19:47716843-47716865 CCTGCTGGAGCAGGAGGTGCCCG 0: 1
1: 0
2: 6
3: 30
4: 277
Right 1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167152221 Original CRISPR GAGGTGCCCGGCTCCCGCGT GGG Exonic
900113322 1:1018716-1018738 GAGGGAGCCGGCTCCCGCCTTGG + Intergenic
900119284 1:1041700-1041722 GAGGTGAGCGGCTCCCCCGGGGG + Exonic
900119304 1:1041747-1041769 GAGGTGGGCGGCTCCCCCGGGGG + Intronic
900119324 1:1041794-1041816 GAGGTGGGCGGCTCCCCCGGGGG + Intronic
900362593 1:2297025-2297047 GAGGTGCCAGGCACCCGCACAGG + Intronic
907189008 1:52633288-52633310 CAGGTGCCCGGCCCGCGCGGAGG - Intergenic
907849794 1:58245261-58245283 AAGGTGCCTGGCTCCCTCCTGGG + Intronic
907980009 1:59472084-59472106 GAGGGGGCCGGCTCCGGCCTTGG - Intronic
908896853 1:68910338-68910360 GAGGTCCCCGACCCCCTCGTGGG - Intergenic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
913109165 1:115642221-115642243 CGGGTGGCCGGCTCCCGCCTCGG + Intronic
915358812 1:155273311-155273333 GAGGTCCCAGGGTCCCGGGTTGG - Intronic
919465351 1:197918014-197918036 GGGGTGCCCGGCTACCGCCGCGG - Intronic
922697369 1:227737520-227737542 CAGGTGCCCCTCTCCCGCTTAGG - Intronic
922831740 1:228557735-228557757 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922832220 1:228609717-228609739 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922832780 1:228611958-228611980 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922833341 1:228614199-228614221 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922833901 1:228616440-228616462 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922834458 1:228618681-228618703 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922835018 1:228620913-228620935 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922835569 1:228623116-228623138 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922836127 1:228625358-228625380 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922836685 1:228627597-228627619 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922837244 1:228629839-228629861 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922837805 1:228632080-228632102 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922838363 1:228634320-228634342 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922838921 1:228636545-228636567 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922839481 1:228638786-228638808 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922840042 1:228641017-228641039 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922840602 1:228643258-228643280 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
922841165 1:228645489-228645511 CAGGAGCCCGGCTCCAGCCTGGG - Intergenic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1068978086 10:63033544-63033566 GAGGGAGCCGGCTCCCGCCTTGG - Intergenic
1076479331 10:130774614-130774636 CAGGGGCCCGTCTCCCACGTGGG - Intergenic
1076796298 10:132799973-132799995 GAGGTGCCCGTCTTCCACCTGGG + Intergenic
1081700083 11:45147112-45147134 GCGGCCCCCGGCTCCCGCGGCGG - Intronic
1088481759 11:110301311-110301333 GAGGTAGCCGGCTCCTGCCTTGG + Intergenic
1091394149 12:143267-143289 TAGGGGCCAGACTCCCGCGTTGG + Intronic
1093793668 12:23285901-23285923 GAGGGGGCCGGCTCCGGCCTTGG - Intergenic
1097212895 12:57386268-57386290 GAGGGAGCCGGCTCCCGCCTCGG - Intronic
1102026728 12:109717943-109717965 TAGGTGCCAGGCTCTGGCGTGGG + Intronic
1102476529 12:113192080-113192102 GAGGTGCCAGGCCCCTGGGTTGG - Exonic
1109149287 13:58823970-58823992 GAGGGACCCGGCTCCGGCCTCGG + Intergenic
1111138831 13:84086781-84086803 GAGGGAGCCGGCTCCCGCCTTGG + Intergenic
1112518591 13:100077471-100077493 GAGGGAGCCGGCTCCCGCCTTGG - Intergenic
1113694307 13:112333073-112333095 GAGGTGCCCAGCTGTGGCGTGGG - Intergenic
1127207287 15:56733680-56733702 CCGGTGCCCGCCTCCCGCGTCGG - Intronic
1132758235 16:1496295-1496317 GAGGGGCCCGGCTTCCTCCTGGG - Intronic
1135942734 16:26836459-26836481 GAGGGAGCCGGCTCCCGCCTCGG + Intergenic
1138478061 16:57283802-57283824 GAAGAGCCCGGCTCCCGCGCGGG + Intronic
1138688722 16:58748806-58748828 GAGGGAGCCGGCTCCGGCGTCGG - Intergenic
1141774695 16:86115419-86115441 GAGGTGCCCGTGTCCTGTGTTGG + Intergenic
1144707137 17:17377162-17377184 GAGGTGCCCGGCGCCCCGGGCGG - Intergenic
1144708628 17:17386068-17386090 GAGGTGCCAGGCTCCTCCCTTGG - Intergenic
1152744326 17:82032005-82032027 ATGCTGCCCGGCTCCCGCTTGGG + Intronic
1152862264 17:82703260-82703282 GCTGTGCCCTGCTCCAGCGTGGG - Intergenic
1153514215 18:5890427-5890449 GAGGTGCCGGCCTCCCGCAGGGG + Exonic
1153812319 18:8762869-8762891 GTGGTGCCCGGCTCAGGCTTGGG + Intronic
1158266381 18:55664846-55664868 GAGGGAGCCGGCTCCCGCCTCGG - Intergenic
1161487684 19:4544412-4544434 GTGGTGTCCGGCTTCAGCGTGGG - Exonic
1162230091 19:9259470-9259492 GAGGGAGCCGGCTCCCGCCTTGG - Intergenic
1162632754 19:11941699-11941721 GAGGGAGCCGGCTCCCGCCTTGG + Intronic
1163695695 19:18762212-18762234 GAGGTGCGCAGCTCCCGGGCGGG - Intronic
1165266887 19:34668150-34668172 GAGGGAGCCGGCTCCCGCCTTGG - Intronic
1166036275 19:40170545-40170567 GAGGGAGCCGGCTCCCGCCTTGG + Intergenic
1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG + Exonic
1168714053 19:58516971-58516993 GAGGTGCCTGGCCCTCGCCTGGG + Exonic
927056198 2:19367627-19367649 GAGGTGCCAGGCTCCTGCTCTGG - Intergenic
927357031 2:22186299-22186321 GAGGGGGCCGGCTCCGGCCTTGG - Intergenic
927645505 2:24874542-24874564 GAGGTGGCCAGCTCCCAGGTTGG - Intronic
932740257 2:74285738-74285760 GAAGTGCCCACCTCCCTCGTGGG + Intronic
944766731 2:202871757-202871779 GAGGTGTCAGGCTCCCGCTGCGG + Intronic
1171013635 20:21521962-21521984 GAGGGGCGCGGCACCCGCGGCGG - Intergenic
1172207489 20:33174246-33174268 GAGGTGCCCGATTCCCAGGTTGG - Intronic
1173672863 20:44810273-44810295 GAGGCGCCCGGCGCCGGCGCGGG - Intronic
1176126050 20:63475322-63475344 GTGGTGCCCAGCTCCAGCGGAGG + Intergenic
1176185486 20:63776090-63776112 CAGGTGCCCGGCTCCCAGGGTGG - Intronic
1179133551 21:38660479-38660501 GACCTGCCCGGCTCCCACGCTGG - Intronic
1180020808 21:45125389-45125411 GAGGTGGCTGGCTCCCGCCTGGG + Intronic
1180185500 21:46137199-46137221 GTGGTGCCCGGACCCCACGTGGG - Intronic
1180338070 22:11597732-11597754 GAGGAGCCCGGCTCCAGCCGGGG + Intergenic
1180669277 22:17540705-17540727 GAAGTGCCCACCTCCCGCGGGGG - Exonic
1183971653 22:41482070-41482092 GTGGTGCCTGGCTCCCCGGTGGG + Intronic
1184035312 22:41915175-41915197 GAGGAGCGCGGCTGCCGCGAGGG + Intergenic
957270958 3:78029894-78029916 GAGGGAGCCGGCTCCCGCCTCGG - Intergenic
968703065 4:2065779-2065801 GAGGTGCCCGGTCCCCGCTTGGG + Exonic
968716112 4:2161226-2161248 GAGGGAGCCGGCTCCCGCCTTGG - Intronic
970803473 4:20003970-20003992 GAGGGAGCCGGCTCCCGCCTTGG - Intergenic
975870764 4:78776332-78776354 CAGCTGCCCGGCTCCCGCAGAGG - Intronic
980824154 4:138053304-138053326 GAGGGAGCCGGCTCCCGCCTTGG + Intergenic
982868858 4:160550520-160550542 GAGGGAGCCGGCTCCCGCCTTGG + Intergenic
982985710 4:162203545-162203567 GAGGGAGCCGGCTCCCGCCTTGG - Intergenic
984952985 4:185020189-185020211 GAGGTGCCCTGCACCCGCTTTGG + Intronic
985403924 4:189617049-189617071 GAGGGAGCCGGCTCCCGCCTTGG + Intergenic
985561328 5:587669-587691 CAGGTGCCCGGCTCCAGCTCTGG + Intergenic
985696832 5:1345463-1345485 GAGGTGCCCGGCTTCTGTGAGGG - Intergenic
985786791 5:1899745-1899767 GAGGTGCCGGGCTCTCCCCTGGG + Intergenic
1000085817 5:157886813-157886835 GAGGGGGCCGGCTCCAGCCTCGG - Intergenic
1002098761 5:176847085-176847107 TGGGTGCCCCGCTCCCGCCTGGG + Intronic
1005711972 6:28511796-28511818 GAGGGGGCCGGCTCCGGCCTTGG - Intronic
1005927248 6:30453732-30453754 GGGGCGCCCTGCTCCCGTGTCGG - Intergenic
1007347129 6:41239689-41239711 GAGGTCCCGGGCTCCCGCGGGGG + Intergenic
1014098237 6:117482782-117482804 ATGGTGCCCGGCGCCCGCGGCGG + Exonic
1021729975 7:23586467-23586489 GAGGTCCCAGGGTCCCGGGTTGG - Intergenic
1029105547 7:98172191-98172213 GAGGCCCCCCGCTCCCGGGTGGG + Intronic
1034967163 7:155398552-155398574 GAGGGGGCCGGCTCCGGCCTTGG + Intergenic
1035812744 8:2506146-2506168 GTGGTGCCCGGCTTCCACGAAGG + Intergenic
1044159323 8:88893542-88893564 GAGTTTCCCTGCTCCCACGTTGG - Intergenic
1049776669 8:144409210-144409232 GCGGGGCCGGGCTCCTGCGTGGG - Intronic
1055462113 9:76528921-76528943 GAGGGAGCCGGCTCCCGCCTCGG + Intergenic
1062621270 9:137423484-137423506 GAGGGGCCAGGATCCCGCGGAGG - Exonic
1202791043 9_KI270719v1_random:90443-90465 GAGGTGCACGGCGCCGGCGCAGG + Intergenic
1203780703 EBV:99262-99284 GAGGCCGCCGGCTCCCGCGCCGG + Intergenic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1201468291 Y:14309243-14309265 GAGGGACCCGGCTCCAGCCTTGG - Intergenic
1201762842 Y:17558164-17558186 CAGGTGCCCGGCTCCAGCCGTGG + Intergenic
1201838710 Y:18347825-18347847 CAGGTGCCCGGCTCCAGCCGTGG - Intergenic
1201901162 Y:19046971-19046993 GAGGGAGCCGGCTCCCGCCTCGG + Intergenic