ID: 1167153862

View in Genome Browser
Species Human (GRCh38)
Location 19:47726178-47726200
Sequence CAGGTCGTTGAGCTTGCGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167153862_1167153874 23 Left 1167153862 19:47726178-47726200 CCTTGCGCAAGCTCAACGACCTG 0: 1
1: 1
2: 0
3: 2
4: 54
Right 1167153874 19:47726224-47726246 AGTGAGTAGTCCTGAGGGCTGGG 0: 1
1: 0
2: 0
3: 16
4: 168
1167153862_1167153871 17 Left 1167153862 19:47726178-47726200 CCTTGCGCAAGCTCAACGACCTG 0: 1
1: 1
2: 0
3: 2
4: 54
Right 1167153871 19:47726218-47726240 GGTGCGAGTGAGTAGTCCTGAGG 0: 1
1: 0
2: 1
3: 3
4: 73
1167153862_1167153872 18 Left 1167153862 19:47726178-47726200 CCTTGCGCAAGCTCAACGACCTG 0: 1
1: 1
2: 0
3: 2
4: 54
Right 1167153872 19:47726219-47726241 GTGCGAGTGAGTAGTCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1167153862_1167153873 22 Left 1167153862 19:47726178-47726200 CCTTGCGCAAGCTCAACGACCTG 0: 1
1: 1
2: 0
3: 2
4: 54
Right 1167153873 19:47726223-47726245 GAGTGAGTAGTCCTGAGGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 317
1167153862_1167153868 -4 Left 1167153862 19:47726178-47726200 CCTTGCGCAAGCTCAACGACCTG 0: 1
1: 1
2: 0
3: 2
4: 54
Right 1167153868 19:47726197-47726219 CCTGGTGAAGAGGGCCCGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 223
1167153862_1167153866 -8 Left 1167153862 19:47726178-47726200 CCTTGCGCAAGCTCAACGACCTG 0: 1
1: 1
2: 0
3: 2
4: 54
Right 1167153866 19:47726193-47726215 ACGACCTGGTGAAGAGGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167153862 Original CRISPR CAGGTCGTTGAGCTTGCGCA AGG (reversed) Exonic
900207373 1:1437314-1437336 CAGGTCCTTGAGCTCCTGCATGG - Exonic
904567023 1:31434309-31434331 CAGGTCCTGGAGCTGGGGCAGGG - Exonic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
919439147 1:197606280-197606302 CTGGTCTTTGATCTTGCGGAGGG - Intronic
919741439 1:200983625-200983647 CAGGTCTTGGAGCCTGTGCATGG - Intronic
922699647 1:227751291-227751313 CAGGTGGTGGGGCTGGCGCAGGG - Intronic
1073022322 10:100455341-100455363 CAGGTCGTTGAGTTTGCTGGAGG - Intergenic
1076693534 10:132236205-132236227 CAGGTGGCAGAGCCTGCGCACGG + Intronic
1083769740 11:64859948-64859970 CAGGTCATTGAGCTTCCTGAGGG + Exonic
1083962451 11:66021803-66021825 CAGGGCGATGATCTTGAGCAGGG + Exonic
1084838529 11:71825757-71825779 CAGGTAGAAGAGCTTGAGCAGGG + Intergenic
1109267488 13:60217795-60217817 CAGGTAGTTAAGCATGAGCAGGG - Intergenic
1123048385 14:105529250-105529272 CAGGTCCTCGCGCTTGCGGAAGG - Exonic
1202902963 14_GL000194v1_random:53767-53789 GATGTCCTTGAGGTTGCGCAGGG + Intergenic
1125508907 15:40282566-40282588 CAGGTCCTTGGGTTTGAGCATGG + Exonic
1130824600 15:87531320-87531342 CAGGTTGTAGAGCTTTAGCATGG - Intergenic
1133418429 16:5624744-5624766 CAGGTCTTTGAGCTTGCCTCAGG + Intergenic
1139676994 16:68530443-68530465 CAGGACGTAGAGCTTGGGCGGGG + Intronic
1141532667 16:84657616-84657638 CAGGTTGTTGTGGTAGCGCACGG - Exonic
1149612255 17:57966117-57966139 CAGGACGGTGAGATTGCGCGGGG + Intergenic
1152094837 17:78266984-78267006 CAGGTCCTTGAGCAGGGGCATGG + Intergenic
1162432332 19:10636522-10636544 CAGGTCGTCCGGCTTGCGCAGGG - Exonic
1167153862 19:47726178-47726200 CAGGTCGTTGAGCTTGCGCAAGG - Exonic
928436942 2:31260876-31260898 GAGGTCGTTGAGCTTGCGCAGGG - Exonic
930979355 2:57503926-57503948 CAGGTAGGAGAGCTTGTGCACGG + Intergenic
935576484 2:104716917-104716939 CAGGGCCTTGAGCTTGGGAATGG - Intergenic
946028061 2:216684159-216684181 AAAGTGGTTGAGCTTGGGCAGGG - Intronic
1172362643 20:34324797-34324819 GAGGTCTGTGAGCTTGTGCAGGG + Intergenic
1172868631 20:38120524-38120546 CAGGGCGCTCAGCTTGGGCAGGG + Intronic
1173485072 20:43435137-43435159 CAGGCAATAGAGCTTGCGCAGGG + Intergenic
1173593871 20:44246668-44246690 CAGCTCGATGACCTTGGGCAAGG + Intergenic
1176622326 21:9068534-9068556 GATGTCCTTGAGGTTGCGCAGGG + Intergenic
1178104499 21:29302521-29302543 CAGGTAGAAGAGCTTGCCCAAGG - Intronic
961388201 3:126536325-126536347 CAGGTCATAGAGCTTCTGCAGGG - Exonic
966912456 3:184567010-184567032 CAGGTCGAGGACCTTGAGCAGGG - Intronic
969107158 4:4816147-4816169 CAGGTCCCTGAGCATGGGCAGGG - Intergenic
969262320 4:6041861-6041883 CAGGTCTGTGAGCTTGCTCCTGG + Intronic
988958643 5:36346864-36346886 CAGGTCTTTGAGTTTGGACAAGG - Intergenic
992994384 5:82318122-82318144 CAGGTAGATGAGCATGTGCAGGG - Exonic
993058640 5:83012250-83012272 TAGCTCGATGAGCTTGAGCAAGG + Intergenic
993285642 5:85992064-85992086 CAGGTAAGTGAGCTTGTGCAGGG - Intergenic
999421324 5:151447403-151447425 CAGGGCATTGATCTTGGGCATGG - Intronic
999726435 5:154442228-154442250 CTGGTAGTTGAGCTTGCCCTTGG - Intergenic
1000109997 5:158099211-158099233 GTGGTGGTTGAGCTTGGGCATGG + Intergenic
1001014496 5:168127985-168128007 CAGGGCTAGGAGCTTGCGCAGGG + Intronic
1002593537 5:180307077-180307099 CAGGGCGTTGGGCTTGGGGAGGG - Intronic
1006067802 6:31474947-31474969 CAGGGCTTTGAGCCTGAGCAGGG + Intergenic
1011692363 6:89882034-89882056 CAGGCCGGAGAGCTTGTGCAGGG + Intergenic
1035528205 8:331194-331216 CAGGTGGTTGAGCTTTGGCCAGG + Intergenic
1037070855 8:14646988-14647010 TAGGTCGTAGAGCTTCCTCATGG + Intronic
1040650711 8:49446275-49446297 CAGATCATTGAGCTTCCTCAGGG + Intergenic
1041748771 8:61236821-61236843 CAGGTCACAGAGCTGGCGCAGGG + Intronic
1053418991 9:37965053-37965075 CAGGTCTTTGGGCTTGTGGATGG - Intronic
1059137742 9:111823183-111823205 CAGGTCTTTGAGCTTGTGCCTGG - Intergenic
1060157304 9:121328792-121328814 CAGTTGGTTGCGCTTGGGCAGGG + Intronic
1060983025 9:127804289-127804311 CAGGGTATTGAGCATGCGCACGG - Exonic
1191602809 X:63028073-63028095 CAGGCAGTAGAGCTTGTGCAGGG + Intergenic
1192550463 X:72049339-72049361 CACTTGGGTGAGCTTGCGCAGGG - Intergenic