ID: 1167158133

View in Genome Browser
Species Human (GRCh38)
Location 19:47751511-47751533
Sequence TATCCACAGACCCCCTGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167158125_1167158133 18 Left 1167158125 19:47751470-47751492 CCTCTTCCATGCTGGGACTGTCC 0: 1
1: 0
2: 0
3: 24
4: 223
Right 1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
1167158126_1167158133 12 Left 1167158126 19:47751476-47751498 CCATGCTGGGACTGTCCCAGCAG 0: 1
1: 0
2: 1
3: 29
4: 231
Right 1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
1167158127_1167158133 -3 Left 1167158127 19:47751491-47751513 CCCAGCAGCTCCCCTCGCTGTAT 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
1167158122_1167158133 27 Left 1167158122 19:47751461-47751483 CCTTTGGTGCCTCTTCCATGCTG 0: 1
1: 0
2: 2
3: 23
4: 258
Right 1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
1167158128_1167158133 -4 Left 1167158128 19:47751492-47751514 CCAGCAGCTCCCCTCGCTGTATC 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167158133 Original CRISPR TATCCACAGACCCCCTGGAC AGG Exonic
901066314 1:6496390-6496412 TATCCACAGAGCCCTGGCACGGG - Intronic
901493602 1:9608983-9609005 TATTCAGAGACGCGCTGGACCGG + Intronic
901653590 1:10756538-10756560 GATCCCCAGCGCCCCTGGACAGG - Intronic
903161813 1:21494465-21494487 TCCCCACAGAGCCCCTGCACTGG + Intergenic
903645097 1:24890670-24890692 TCTCAACAGACCCCCTTCACTGG - Intergenic
904441763 1:30536358-30536380 TTTCCTCAGACCCCTTTGACTGG - Intergenic
905421361 1:37847648-37847670 TATCCACAGAACGCCTGCAGGGG + Intronic
906287173 1:44595045-44595067 CATCCACAGACCCGCAGCACTGG + Intronic
919789517 1:201281823-201281845 TAGCCATAGACCGCCAGGACTGG - Intergenic
922228078 1:223663183-223663205 TTTCCACAGACCACGAGGACAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924477630 1:244395575-244395597 TCTCCACTGACTCCTTGGACAGG + Intergenic
1063411635 10:5840817-5840839 TGCCCACAGACCCCCCAGACAGG - Intronic
1065378988 10:25069896-25069918 TATGCAGAGACCCCCTGGGAGGG + Intergenic
1069701190 10:70427626-70427648 AATCCACAGACCCGCTGAACAGG - Exonic
1072521777 10:96236018-96236040 CATTCCCAGACCCCCTGGTCTGG - Intronic
1073396768 10:103224431-103224453 GTTCCACAGACCCCTAGGACAGG + Intergenic
1075667766 10:124243227-124243249 TATGCACAGAGCCCCACGACTGG - Intergenic
1075774292 10:124969972-124969994 TTTCCAAAAACCACCTGGACTGG - Intronic
1076668896 10:132108361-132108383 AATCCACTGTCCCCCGGGACTGG - Intronic
1077372174 11:2188112-2188134 TATCCACACAGCCTCTGGGCGGG + Intergenic
1082763498 11:57148544-57148566 TGTCCACACACACCCTGGTCAGG + Intergenic
1086856599 11:91873153-91873175 TAAAAACAGACTCCCTGGACGGG - Intergenic
1088712935 11:112524690-112524712 TTTCCAAAGACCCTCTGGTCAGG - Intergenic
1088953932 11:114599184-114599206 GTTCCACAGATCCCTTGGACAGG + Intergenic
1090211666 11:124925056-124925078 TGTTCACAGACCCCCTGGAGGGG - Exonic
1091240587 11:134049596-134049618 CATCCAGAGACCCCCTGGGGAGG - Intergenic
1091932821 12:4410422-4410444 TCTCCACTGACACACTGGACAGG + Intergenic
1092395407 12:8121661-8121683 TATCCTCTGACACCCTGCACTGG - Intergenic
1095547015 12:43384603-43384625 TGTCCCCAAACCCCCTCGACAGG + Intronic
1096365683 12:51026603-51026625 GACCCACACAGCCCCTGGACTGG + Intronic
1100915372 12:99414674-99414696 TAACCCCTCACCCCCTGGACAGG - Intronic
1102421137 12:112803809-112803831 TGTCCCCAGACCACCTGGATTGG + Intronic
1103030388 12:117607625-117607647 CATCCACAGACCTCCCGGAGAGG + Intronic
1105969154 13:25412538-25412560 TATCCACAGAACCACTGGCCAGG + Intronic
1107994447 13:45846964-45846986 TATTCACAGAACCCATGGGCTGG + Intronic
1109773958 13:67015226-67015248 TCTGCACACACTCCCTGGACAGG + Intronic
1110043167 13:70792147-70792169 TATCCCCATACACCCTGGTCAGG + Intergenic
1111824561 13:93251227-93251249 TTTGCACAGACCCCTTGGGCAGG + Intronic
1113120155 13:106917272-106917294 TCCCCTCAAACCCCCTGGACCGG - Intergenic
1114311654 14:21473048-21473070 TATCCCCTGATCCCCTGCACTGG - Intronic
1114330664 14:21634018-21634040 GCTCCAAAGACCCCCTGGATGGG - Exonic
1118631478 14:67707870-67707892 TATCTACACAGCCCCTGTACAGG - Intronic
1121041299 14:90750905-90750927 TATTTACAGGCCCTCTGGACTGG + Intronic
1121225939 14:92322374-92322396 TAGTCACAGACCCCCTGGGCTGG + Intergenic
1126181660 15:45791450-45791472 TATCCAATGAACCCCTGGGCAGG + Intergenic
1126411186 15:48374807-48374829 TATGCACAGAAAACCTGGACTGG + Intergenic
1127274732 15:57432227-57432249 TAGCCACAGGGCCCCTGGAATGG + Intronic
1128891652 15:71337294-71337316 TACCCTCGGTCCCCCTGGACTGG - Intronic
1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG + Intronic
1137305890 16:47199658-47199680 TTTCCATGGACCCCATGGACCGG + Intronic
1138160059 16:54745096-54745118 CAACCTCAGACCCCCAGGACTGG - Intergenic
1139606443 16:68022399-68022421 CTTCCACAGAGCCCCTGGAGTGG + Exonic
1139650709 16:68360753-68360775 TAGCCACAGACCCCTTGCTCGGG - Exonic
1145140120 17:20444247-20444269 CATCCGCAGGCCCCCGGGACAGG + Intergenic
1146307430 17:31741339-31741361 TTTCCTTAGACCCCCTGTACTGG + Intergenic
1146568889 17:33936391-33936413 TGTCCACAGACCACCTCGCCTGG - Intronic
1155170022 18:23260290-23260312 TAACCACAGACACCCTGGCAGGG - Exonic
1157467038 18:47956227-47956249 TAGCCACTGGTCCCCTGGACAGG - Intergenic
1161155625 19:2730862-2730884 TACTTACAGACCCCCTGGAGTGG + Intronic
1161155679 19:2731053-2731075 TACTTACAGACCCCCTGGAGTGG + Intronic
1161899848 19:7110237-7110259 AATCCAGAGACCGCCTGGAGGGG + Intergenic
1164027046 19:21361790-21361812 TATCCACTTGCCCCCTTGACAGG - Exonic
1167158133 19:47751511-47751533 TATCCACAGACCCCCTGGACAGG + Exonic
925061080 2:890779-890801 TGGCCACAGACACACTGGACCGG - Intergenic
926079881 2:9976453-9976475 GGTCCACAGACCCCATGGATTGG - Intronic
932448839 2:71796855-71796877 TATTCACAGACCTGCAGGACGGG - Intergenic
937863281 2:126729993-126730015 AAGCCACAGACTCCCTGGAACGG + Intergenic
938671786 2:133593920-133593942 TATCCACAGACCCTCTAGGCAGG + Intergenic
946171630 2:217899160-217899182 TCTCCACACCCCACCTGGACTGG - Intronic
947867156 2:233406600-233406622 TATCCACAGACCGCTTTGAGGGG - Intronic
1174633743 20:51980818-51980840 TTTCCACAGACCCGCTGGTAGGG - Intergenic
1176065269 20:63191058-63191080 CATCCACAGAGCCCCGTGACGGG + Intergenic
1177323013 21:19546285-19546307 TCTCCAAAGACCCTCTTGACAGG - Intergenic
1178189508 21:30264095-30264117 TTTCCACAGAGACCCTGGGCTGG + Intergenic
1179128157 21:38611005-38611027 TATCCACAAACCAGCAGGACTGG + Intronic
1184337990 22:43866379-43866401 TATTCACAGGCTCCCAGGACTGG + Intergenic
1184457750 22:44621128-44621150 TCTCCCCAGTCCCTCTGGACTGG - Intergenic
950201990 3:11050919-11050941 TCTCCAGAGACCACCTCGACAGG - Intergenic
952196042 3:31076195-31076217 TCCCCACTGAGCCCCTGGACTGG + Intergenic
959351479 3:105270071-105270093 TATGCAAAGAGCCCCTGGACAGG - Intergenic
960869363 3:122233386-122233408 CAGCCAAAGACCCCCAGGACTGG - Intronic
961616011 3:128181650-128181672 TATGCACAGCCCACCTGGGCTGG + Intronic
961645591 3:128391177-128391199 AATGCACAGACTCCCTGGCCTGG + Intronic
962603621 3:137013791-137013813 TTTCCACCGAACCCCTTGACAGG - Intergenic
963060340 3:141220360-141220382 CATCCCCAGACCTCCTGAACAGG + Intergenic
965858558 3:173119148-173119170 TTTCCCCACACCCCCTCGACAGG - Intronic
969054134 4:4391015-4391037 TGTCCACAGCCCTCCAGGACTGG - Intronic
973073492 4:45894785-45894807 GGCCCACAGACCCCCTGAACAGG + Intergenic
978320243 4:107485445-107485467 TAGCCCCTGACCCCCTGGACAGG - Intergenic
980516160 4:133865695-133865717 TTTCCACAGACCCTGTGGTCTGG + Intergenic
982221045 4:153125610-153125632 CATTCACAGTCCCCCTGGATTGG + Intergenic
986442775 5:7796324-7796346 TATCCAAAGACGCCCTGCCCTGG - Intronic
990985674 5:61638882-61638904 TATCCGCAGAGCCCCTGCACAGG - Intronic
996964797 5:129295064-129295086 AATCCCCAGACCCCCTAGATAGG + Intergenic
998003578 5:138642848-138642870 TGTCCAGAGACTCCCTGGGCTGG + Intronic
998061003 5:139118755-139118777 TATCCACACACACCCTTGAGAGG + Intronic
999124304 5:149235726-149235748 TACCCACACACCCCCAGAACTGG + Intronic
999325347 5:150640313-150640335 TTTGCACAGACCCCCTCTACCGG - Intronic
999829217 5:155303262-155303284 TAGCCACTGAGCCCCTGAACTGG + Intergenic
1001124652 5:169008473-169008495 AATCCACAGACCTCTTGGGCAGG + Intronic
1002705389 5:181157885-181157907 TAGCCACTGAACCCCTAGACTGG + Intergenic
1003743871 6:8977382-8977404 TGTCAACAGACTCCCTGGAGAGG + Intergenic
1006603272 6:35239537-35239559 TGGCCACAGATCCCCTGAACAGG + Intronic
1016889606 6:148992975-148992997 TATCCACAGACCCCTTTGGGCGG + Intronic
1022122458 7:27322710-27322732 TGGCCACAGAACCCATGGACAGG - Intergenic
1024258741 7:47558644-47558666 TAACCACAGCCTCCCTGGGCAGG + Intronic
1024270662 7:47639067-47639089 CTTCCACAGTCTCCCTGGACTGG + Intergenic
1033122346 7:138677219-138677241 TATCCCTACACCCCCTGGACTGG + Intronic
1033141708 7:138833081-138833103 TATCCACATTTGCCCTGGACAGG - Intronic
1034355707 7:150449448-150449470 GATCCACCCTCCCCCTGGACTGG - Intergenic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1041428257 8:57748118-57748140 TATCCTAAGACCTCCTGGACTGG + Intergenic
1043069170 8:75617231-75617253 CATGCTCAGACACCCTGGACAGG + Intergenic
1045079113 8:98604930-98604952 GATCCACAGATCCCCAGGGCAGG + Intronic
1047984888 8:130222290-130222312 TATTCACAAAACCTCTGGACTGG + Intronic
1049216835 8:141412207-141412229 CATACCCAGACGCCCTGGACAGG - Intronic
1049849894 8:144825346-144825368 AATCCACAGAGCCCCTCCACAGG - Intergenic
1051337107 9:16076050-16076072 CATCCACAGACCCTCTGCATTGG - Intergenic
1053202480 9:36162223-36162245 TCTTCACAGACCCCCTGCAGGGG - Intronic
1059340171 9:113593668-113593690 TTTCCCTAGACCCCCTGTACAGG - Intronic
1060890273 9:127183631-127183653 TCTCCACAGACCCCCTGCGGAGG - Intronic
1062502334 9:136856925-136856947 ACCCCACAGACCCCCTGGCCTGG + Exonic
1187730130 X:22244276-22244298 TAGCCCCCGACCCCCTGGACAGG - Intronic