ID: 1167162047

View in Genome Browser
Species Human (GRCh38)
Location 19:47774354-47774376
Sequence AGGAGCCAGGGGCTTAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167162037_1167162047 11 Left 1167162037 19:47774320-47774342 CCTGTGACAACCACAGTGGCTTG No data
Right 1167162047 19:47774354-47774376 AGGAGCCAGGGGCTTAGAGAGGG No data
1167162039_1167162047 1 Left 1167162039 19:47774330-47774352 CCACAGTGGCTTGGCCAGCGATG No data
Right 1167162047 19:47774354-47774376 AGGAGCCAGGGGCTTAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167162047 Original CRISPR AGGAGCCAGGGGCTTAGAGA GGG Intergenic
No off target data available for this crispr