ID: 1167163332

View in Genome Browser
Species Human (GRCh38)
Location 19:47781343-47781365
Sequence CATCAAAGCCGCCTTGGCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167163332 Original CRISPR CATCAAAGCCGCCTTGGCTC AGG Exonic
901343066 1:8512805-8512827 CATGGAAGCCACCATGGCTCTGG + Intronic
901444824 1:9301739-9301761 CACCAAAGCCGACCTGGCTATGG + Intronic
903510869 1:23874084-23874106 TGTCAAGGCCTCCTTGGCTCTGG - Exonic
904520904 1:31094992-31095014 CATCAAAGCTGCCTTGGCTCAGG - Intergenic
904666053 1:32122440-32122462 CATCAAAACCGTCTTTGCACAGG - Intronic
904982936 1:34522041-34522063 CATCAAAAGAGCCTGGGCTCTGG + Intergenic
907935541 1:59038848-59038870 CAGCATAGCCACCTTGGTTCTGG + Intergenic
922212996 1:223499897-223499919 CATCACAGCCACCTTGTCTTTGG - Intergenic
1063552170 10:7043746-7043768 CATCCAAGCAGCTTTGGCCCAGG + Intergenic
1064519307 10:16184952-16184974 CATCAAAACTGACTTGGCTTTGG - Intergenic
1067781533 10:49210985-49211007 CATCAATGGCGGCCTGGCTCTGG + Intergenic
1076424505 10:130358060-130358082 CTTGAAAGCCACCTTGGCTTTGG - Intergenic
1076746245 10:132516146-132516168 CTACAAAGCCTCCTTGACTCTGG + Intergenic
1083187873 11:61027894-61027916 CATCAAAGCCCCTCTGGCTGTGG + Intergenic
1083302066 11:61744663-61744685 GATCCCAGCCACCTTGGCTCTGG - Exonic
1090413695 11:126526559-126526581 GATCAAGGACGGCTTGGCTCTGG - Exonic
1090708653 11:129364408-129364430 CAGCCAAGCCGCTTTGGCTCTGG - Intergenic
1095420260 12:42017888-42017910 CATCAAAGCCCCTTTTCCTCAGG - Intergenic
1095420503 12:42019240-42019262 CATCAAAGCCCCTTTTCCTCAGG + Intergenic
1102292883 12:111715334-111715356 CATGAAAGCAGCTTTGGGTCAGG + Intronic
1111339266 13:86862535-86862557 CATGAAAGCTGCCATGGCTTAGG - Intergenic
1111653005 13:91116239-91116261 GATCAAAGATGCCTTGGCTAAGG + Intergenic
1122742983 14:103882525-103882547 CATAAAAGCCCCGTCGGCTCTGG + Intergenic
1125541877 15:40474380-40474402 CTTCAGAGTCCCCTTGGCTCTGG + Exonic
1127980872 15:64034085-64034107 CATAAAAGCCCCCTTGCTTCAGG + Intronic
1136068314 16:27773317-27773339 AAGCAAAGCCCCCTGGGCTCTGG - Intronic
1136524706 16:30821490-30821512 CATCAAAGCAGACGTGGCTCTGG + Intergenic
1137482861 16:48866849-48866871 CATCCAGGTCTCCTTGGCTCTGG + Intergenic
1138659467 16:58508890-58508912 CATCAAACCTGCCTTGGCAATGG + Intronic
1140530434 16:75661067-75661089 CATCAGAGCCCTCTTGGCACAGG + Intronic
1140927684 16:79599515-79599537 CATCGAAGCCGCCCTGGAGCTGG + Exonic
1144308254 17:13988886-13988908 CATCACATCCGCCTTGGTTGTGG + Intergenic
1150638553 17:66933766-66933788 AATCAAAGCTCCCTTGGCACAGG - Intergenic
1153514900 18:5894216-5894238 CAGCAAGGCAGCTTTGGCTCCGG + Intronic
1153681988 18:7509627-7509649 CATCACAGGGCCCTTGGCTCAGG - Intergenic
1157522501 18:48355053-48355075 CATCAAAGCCTACTGGGCCCTGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159241509 18:65749564-65749586 CATCCAAGCAGCCCTGGATCTGG + Intergenic
1160240668 18:77120102-77120124 CATGAATCCCGCCTTGTCTCGGG + Intronic
1161364690 19:3871591-3871613 CATGGAAGCCGCCATGGCCCCGG + Intergenic
1167119952 19:47510950-47510972 CATCAAAGCCCCCTAGCGTCTGG + Intronic
1167163332 19:47781343-47781365 CATCAAAGCCGCCTTGGCTCAGG + Exonic
1167349614 19:48966319-48966341 CATGAAAGCTGCCATGGCCCTGG + Exonic
1167359680 19:49023504-49023526 CATCAATGCCACCCTGGCTGTGG - Exonic
1167361451 19:49032581-49032603 CATCAATGCCACCCTGGCTGTGG + Exonic
1167362202 19:49036204-49036226 CATCAATGCCACCCTGGCTGTGG - Exonic
1167363881 19:49044654-49044676 CATCAATGCCACCCTGGCTGTGG + Exonic
1167364617 19:49048273-49048295 CATCAATGCCACCCTGGCTGTGG - Exonic
1167365902 19:49054909-49054931 CATCAATGCCACCCTGGCTGTGG - Exonic
925545635 2:5012880-5012902 GATCCAAGACACCTTGGCTCTGG - Intergenic
930634326 2:53787490-53787512 CATAAAAGCAGCTTTGGCTTGGG - Intronic
935553368 2:104481345-104481367 CAGGAAAGCAACCTTGGCTCAGG + Intergenic
935683472 2:105660108-105660130 CATCAAAGTTTCCTTGGTTCTGG - Intergenic
937086326 2:119174292-119174314 TATCAAAGCCCCCTGGGCTGGGG + Intergenic
940343290 2:152603209-152603231 CAGCAAAGCAGCCTTGGGTCTGG + Intronic
947500313 2:230666641-230666663 CATCAGAGCCTCCTGGGTTCCGG - Intergenic
1169245888 20:4024204-4024226 CATGAAAGCTGCCATGGCCCTGG + Intergenic
1171192709 20:23170511-23170533 CAGCAAAGGCGACCTGGCTCTGG + Intergenic
1176346589 21:5753960-5753982 AATCAAAGAAGCCTTGACTCAGG - Intergenic
1176353403 21:5874544-5874566 AATCAAAGAAGCCTTGACTCAGG - Intergenic
1176498238 21:7570495-7570517 AATCAAAGAAGCCTTGACTCAGG + Intergenic
1176540910 21:8152030-8152052 AATCAAAGAAGCCTTGACTCAGG - Intergenic
1176559861 21:8335075-8335097 AATCAAAGAAGCCTTGACTCAGG - Intergenic
1178924360 21:36762472-36762494 CAGCGAGGCCGCCTTGGGTCTGG + Intronic
1180037155 21:45255912-45255934 CTTCAAAGCCAACTTGGGTCAGG + Intergenic
1181669836 22:24420887-24420909 CATCACAGCCTCCTTGGCACTGG + Intronic
1184464066 22:44658831-44658853 CAGCACCGCTGCCTTGGCTCAGG + Intergenic
1185385451 22:50529695-50529717 CATCAAGGCTGCCATCGCTCCGG + Exonic
1203245849 22_KI270733v1_random:68449-68471 AATCAAAGAAGCCTTGACTCAGG - Intergenic
950281975 3:11715922-11715944 CATCACAGCCTTCTTGGCTGAGG + Intronic
950661229 3:14468286-14468308 CCTCAAAGCCCCCTGGGGTCTGG - Intronic
951851631 3:27147561-27147583 CTTCAAAGCAGCCTTGCCTCTGG - Intronic
952401626 3:32968723-32968745 AATCAAAGAAGCCTTGACTCAGG + Intergenic
952903110 3:38122361-38122383 CATCATAGGAGCCTTGGCCCCGG - Exonic
953122370 3:40057312-40057334 CATCAAAGCCGGCTTGTTACTGG + Intronic
959679265 3:109074224-109074246 CCTGAAATCCGCCATGGCTCGGG - Intronic
974724166 4:65777601-65777623 CATGAAAGCTGCCAAGGCTCAGG - Intergenic
974976853 4:68903398-68903420 AATCAAAGAAGCCTTGACTCTGG - Intergenic
974988798 4:69060489-69060511 AATCAAAGAAGCCTTGACTCAGG + Intronic
982299879 4:153867710-153867732 CATAAAAGCCGCCAAGGCTTGGG - Intergenic
985804934 5:2036268-2036290 CATCCAAGGCGCCCTGGCTTAGG - Intergenic
985838371 5:2287748-2287770 CTTCAAAGCCACCTTTCCTCTGG - Intergenic
1001256971 5:170191119-170191141 CTTCAAAGCCACCTTGCCTGGGG - Intergenic
1001323547 5:170702427-170702449 CATCAAAGCAGCCTCCACTCTGG - Intronic
1002877455 6:1224160-1224182 CATGAAACCCTCCTTGGTTCGGG - Intergenic
1017576213 6:155807597-155807619 CCACAAAGCTGCCTTGGCTTAGG - Intergenic
1023831136 7:44039604-44039626 CATCCAAGCCTCCTTGGCCCTGG + Intergenic
1024286033 7:47758347-47758369 AATCAAAGCCAGCTGGGCTCAGG - Intronic
1024497774 7:50068053-50068075 AATCAAAGAAGCCTTGACTCAGG - Intronic
1029125741 7:98294073-98294095 CTGCAAAGCCGCCTTTTCTCAGG - Exonic
1029600568 7:101561009-101561031 CTTCCAAGCCCCATTGGCTCTGG + Intergenic
1029741464 7:102493910-102493932 CATCCAAGCCTCCTTGGCCCTGG + Exonic
1029759456 7:102593079-102593101 CATCCAAGCCTCCTTGGCCCTGG + Exonic
1029776823 7:102688989-102689011 CATCCAAGCCTCCTTGGCCCTGG + Intergenic
1034281770 7:149859563-149859585 CATCATAGCCGCCTGGGCCCTGG - Intronic
1035171301 7:157018899-157018921 CATCAAAGCCTTATTTGCTCAGG + Intergenic
1035658193 8:1327255-1327277 CATCACATCCGCCTTGGCCAAGG - Intergenic
1039419781 8:37426595-37426617 CATCAAAGCCACATTGTATCAGG - Intergenic
1039434333 8:37549257-37549279 CAGCAAAGCGGCCCTGGCTCTGG - Intergenic
1047552285 8:125887711-125887733 CTTCAAAGGGGCCTTGTCTCAGG + Intergenic
1049449892 8:142654974-142654996 CCTCAAAGCCACCTTGGGGCAGG - Intergenic
1049480233 8:142819146-142819168 CATCAGAGCAGCCCTGGCTGTGG - Intergenic
1051368939 9:16341905-16341927 CATCATGGCCCCCTTGCCTCCGG + Intergenic
1055785499 9:79865324-79865346 CATCTGAGCCTCCTTGGTTCTGG + Intergenic
1203462186 Un_GL000220v1:51520-51542 AATCAAAGAAGCCTTGACTCAGG - Intergenic
1186334009 X:8566959-8566981 CATCATAGCTGCCTTTGATCAGG - Intronic
1188480328 X:30630585-30630607 CATGAAAGCCGCCATGGCCCCGG + Intergenic
1189129624 X:38484961-38484983 CATGGAAGCCGCCCTGGCCCTGG - Intronic
1200284565 X:154807669-154807691 CATCAGAGCCTCCATGGATCTGG - Intronic