ID: 1167166471

View in Genome Browser
Species Human (GRCh38)
Location 19:47802975-47802997
Sequence TCCCCTCTGCCCCCCAGGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 2, 1: 0, 2: 4, 3: 54, 4: 413}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167166471_1167166476 -4 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166476 19:47802994-47803016 GGGACAGGGAGAAGGTGTGAAGG 0: 2
1: 0
2: 6
3: 126
4: 1081
1167166471_1167166480 10 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166480 19:47803008-47803030 GTGTGAAGGAGGGGCTCGCGCGG 0: 1
1: 1
2: 1
3: 10
4: 161
1167166471_1167166477 -1 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166477 19:47802997-47803019 ACAGGGAGAAGGTGTGAAGGAGG 0: 2
1: 0
2: 6
3: 104
4: 945
1167166471_1167166478 0 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166478 19:47802998-47803020 CAGGGAGAAGGTGTGAAGGAGGG 0: 2
1: 0
2: 4
3: 69
4: 1009
1167166471_1167166482 28 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166482 19:47803026-47803048 CGCGGCCCAGTGAGCCTTTTGGG 0: 1
1: 0
2: 0
3: 0
4: 42
1167166471_1167166481 27 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166481 19:47803025-47803047 GCGCGGCCCAGTGAGCCTTTTGG 0: 1
1: 0
2: 0
3: 1
4: 55
1167166471_1167166479 1 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166479 19:47802999-47803021 AGGGAGAAGGTGTGAAGGAGGGG 0: 1
1: 0
2: 5
3: 121
4: 1161
1167166471_1167166483 29 Left 1167166471 19:47802975-47802997 CCACACCTGGGGGGCAGAGGGGA 0: 2
1: 0
2: 4
3: 54
4: 413
Right 1167166483 19:47803027-47803049 GCGGCCCAGTGAGCCTTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167166471 Original CRISPR TCCCCTCTGCCCCCCAGGTG TGG (reversed) Exonic
900350906 1:2234113-2234135 GCTGGTCTGCCCCCCAGGTGAGG + Intronic
900701010 1:4048611-4048633 ACCACTGTGGCCCCCAGGTGAGG - Intergenic
900791825 1:4685812-4685834 TCCCCTCTGCCTCCTTGGTGGGG + Intronic
900884074 1:5403114-5403136 TCCCCTCTGTCTGCCATGTGAGG - Intergenic
901192467 1:7420809-7420831 GCCCCTCTGCCCCCCTGGCTGGG - Intronic
902222987 1:14978620-14978642 TGCCCTCTGCAGCCCAGGGGTGG - Intronic
902363906 1:15958556-15958578 TCCCCTCAGCCCACCAGTTATGG - Intronic
902572119 1:17353572-17353594 TCTCCCCTGCCTCCCAGGAGAGG - Intronic
903125646 1:21245579-21245601 TTCCCTGTGCCCTGCAGGTGGGG - Intronic
903284384 1:22267909-22267931 TCCCCTGCAGCCCCCAGGTGCGG - Intergenic
903550925 1:24157019-24157041 GCCCCTCCGCCGCCCAGGGGAGG + Exonic
903761128 1:25699587-25699609 TCGACTCTGCCACCCAGATGAGG + Intronic
904307358 1:29598858-29598880 TCTGCTCTGCCTCCCAGGTGGGG - Intergenic
904599491 1:31665729-31665751 TCCCCTCTGCCCACCATGGCTGG + Intronic
905010608 1:34744647-34744669 TCCCCTCTCTCCAGCAGGTGCGG + Intronic
905178389 1:36152061-36152083 TCTCCTCTGCCCCCACTGTGAGG + Intronic
905289177 1:36909934-36909956 ATTCCTCTGCCTCCCAGGTGAGG + Intronic
905370667 1:37481117-37481139 TCCCAGCAGCTCCCCAGGTGGGG + Intronic
905617063 1:39408766-39408788 TCCCCTCTGGCCCCGGGGCGCGG + Intronic
905887836 1:41501316-41501338 TCCCCTGTGGCCTGCAGGTGGGG - Intergenic
906142821 1:43543937-43543959 CCCCTGGTGCCCCCCAGGTGAGG + Intronic
906933219 1:50189542-50189564 CCTCCTCTGCCACCCTGGTGGGG - Intronic
906959174 1:50405181-50405203 CAGCCTCTGCCTCCCAGGTGCGG - Intergenic
912976964 1:114339732-114339754 TCCCTTCTGCTCCACAGGGGTGG - Intergenic
913987974 1:143583238-143583260 TCCCTTGTGCTTCCCAGGTGAGG + Intergenic
915275358 1:154784532-154784554 TCCCTTCTGACTCCCAGGTGGGG + Intronic
915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG + Intergenic
915549534 1:156624334-156624356 TCCCCGCCACCCCCTAGGTGTGG + Exonic
917531737 1:175842032-175842054 TCCCTTCTGCCAACCTGGTGGGG - Intergenic
917643037 1:177001738-177001760 TACACTCTGCCCTGCAGGTGTGG - Intronic
920351053 1:205338304-205338326 TCCACTGTGGGCCCCAGGTGTGG - Intronic
921964078 1:221069229-221069251 TCCCCTCTGTGTCCCAGGAGAGG - Intergenic
922707564 1:227797273-227797295 TCCACTCTTCCACACAGGTGGGG + Intergenic
1062867099 10:864919-864941 TCTGCTCTGTCCCCCAGGTTGGG - Intronic
1062894221 10:1090619-1090641 CCCGCTCTGGCCCCCAGGAGAGG + Intronic
1064162535 10:12958685-12958707 TCTCCCCTGCCCCCCAGCTCTGG - Intronic
1064356961 10:14627740-14627762 TTCACTCTGTCCCCCAGGCGAGG - Intronic
1064435994 10:15311670-15311692 TACTCTATGCCTCCCAGGTGGGG - Intronic
1064701121 10:18023144-18023166 TCCCTGCTGCCCCCCAGCTGGGG - Intronic
1065343077 10:24723978-24724000 TCCCCTCCCCTCCCCAGGGGAGG + Intergenic
1065989167 10:30991204-30991226 TCCCCTCAGCTCCCAAGCTGGGG + Intronic
1066139411 10:32488419-32488441 TCCCTTGTGCTTCCCAGGTGAGG + Intronic
1067660783 10:48235010-48235032 TCCCTTCTTCCCCTCAGCTGAGG + Intronic
1067702205 10:48582101-48582123 CCCTCTCTGCCCCCAAGCTGTGG + Intronic
1067942862 10:50670615-50670637 TACCATCTGCCCCCTGGGTGGGG - Intergenic
1068628937 10:59279968-59279990 TGCCCTCTTCCCTCCATGTGAGG - Intronic
1069994049 10:72332009-72332031 TCCCCCCTGCCCTCCCTGTGTGG - Intergenic
1070627070 10:78058786-78058808 TTCCTGCTGCCCCACAGGTGGGG + Intergenic
1070630528 10:78081581-78081603 ACCCCTCTCTCCCCGAGGTGAGG - Intergenic
1070931472 10:80264059-80264081 TGCCCTCTGACCTCCAGGCGTGG - Intergenic
1071871892 10:89805066-89805088 TCTCTTCTGCCCCCCTGGTGAGG - Intergenic
1072373879 10:94794294-94794316 CCCCTTGTGCCTCCCAGGTGAGG + Intronic
1072438804 10:95436364-95436386 GCCCCTCTGCACCCACGGTGTGG - Intronic
1072616230 10:97050400-97050422 TGCCCTCTGGCCCCCCGGTTGGG + Intronic
1072620045 10:97073708-97073730 TCCCCTGTGACACCCAGCTGTGG - Intronic
1072750373 10:97974674-97974696 TCCCCTCTGCCCCTCCGCTCGGG + Intronic
1073074739 10:100816792-100816814 TCCCCTCTTCTCCCCAGTGGTGG + Intronic
1073085819 10:100888083-100888105 TCTGCTCTGCCCCCTAGTTGGGG + Intergenic
1073328901 10:102658336-102658358 TCCCCTATCCCCCCCAGGCCTGG + Exonic
1074153924 10:110782154-110782176 TTCTCTCTGCAACCCAGGTGGGG - Intronic
1074720140 10:116257079-116257101 TCCCCACTGTCCACCAGGGGAGG + Intronic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1077253451 11:1570884-1570906 TCCCCTCAGACCCCCCGCTGGGG + Intronic
1077615473 11:3670805-3670827 TACCCTCTCCCCTCCAGGTCAGG + Intronic
1078916510 11:15783678-15783700 TTCCCTCAGGCCCTCAGGTGCGG - Intergenic
1079035272 11:17014668-17014690 TCCCCTTTGCCCCCGAGGCCGGG + Intergenic
1079092523 11:17491133-17491155 TCCCCTCTGACTCCCAGATACGG + Intergenic
1079454907 11:20627963-20627985 TCCCTTTTGCCTCTCAGGTGTGG + Exonic
1080709988 11:34737700-34737722 CCCCTTCTGCTTCCCAGGTGAGG - Intergenic
1080826224 11:35851545-35851567 TCCAAGCTGGCCCCCAGGTGGGG - Intergenic
1082136529 11:48555327-48555349 CCCCCTGTGCTTCCCAGGTGAGG + Intergenic
1082613869 11:55335222-55335244 TCCCTTGTGCTTCCCAGGTGAGG + Intergenic
1082684308 11:56219658-56219680 TCCCTTGTGCTTCCCAGGTGAGG - Intergenic
1084268644 11:68017580-68017602 TGCCCTCTGCGCCCCAAGGGAGG - Intronic
1084563358 11:69916204-69916226 TCCCCTCTTTCCCCCAGCTTTGG + Intergenic
1085349623 11:75790171-75790193 GGCCATCTGCCCCCCAGGAGTGG + Exonic
1086414148 11:86571851-86571873 TGCCTGCTGCCTCCCAGGTGTGG - Intronic
1086730241 11:90240259-90240281 CCCCCTGTGCTTCCCAGGTGAGG - Intergenic
1087100443 11:94358898-94358920 CCCCTTGTGCCTCCCAGGTGAGG - Intergenic
1087558643 11:99754921-99754943 TCCCCTCTGCCCCCAAGCCCTGG + Intronic
1089528011 11:119109327-119109349 TCCGCACTGCTCTCCAGGTGGGG + Intronic
1089677848 11:120102242-120102264 GCCCATCTGACCCCCAGATGAGG + Intergenic
1089684114 11:120135944-120135966 TGCCCTTTGCCCCACAGATGTGG - Intronic
1089698248 11:120228851-120228873 TTGCCTCTCTCCCCCAGGTGTGG + Exonic
1090521409 11:127483341-127483363 TTCCCTTTGCCTCCCAGTTGTGG + Intergenic
1091773413 12:3168530-3168552 TCCCCACCGCCCCCCAGCTCTGG - Intronic
1091796347 12:3299438-3299460 TCCCTGCTGCCCTCCAGGTTTGG - Intergenic
1092117938 12:6022734-6022756 TGCCCACTGCCCTCCAGGTGAGG - Exonic
1095052736 12:37568614-37568636 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1096043404 12:48540534-48540556 TCCCCTCTGGCCCTCAGGTGTGG - Intergenic
1096193441 12:49634315-49634337 TCCCCTGTGCCCTCCAGTTCTGG + Exonic
1096560568 12:52433247-52433269 TCTCTTCTTCCCTCCAGGTGAGG - Exonic
1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG + Intergenic
1097052198 12:56230362-56230384 TCCCCCCTCCTCCCCAGGTTAGG + Intronic
1097288442 12:57895144-57895166 TCCACTCTGCCTCCCAGGACAGG - Intergenic
1098183264 12:67870147-67870169 CCCCCTGTGCTTCCCAGGTGAGG + Intergenic
1100442995 12:94634695-94634717 TCCCTACTGCTCCCCAGGTAGGG + Intronic
1100834269 12:98551414-98551436 TTACCTCTGCCTCCCAGGTTCGG - Intergenic
1101500767 12:105301694-105301716 CCTCCTCTGCCCACCAGGTATGG - Intronic
1102027664 12:109722730-109722752 CCCACACTGCCCGCCAGGTGTGG - Intronic
1102905950 12:116675398-116675420 TCCCCTCTGGCCTGCAGGAGAGG - Intergenic
1103905945 12:124327199-124327221 TACCCTCTGCCCCCCAGCCCCGG - Intronic
1104375821 12:128265528-128265550 TGCCCCCTGCCCCCAAGGTCAGG + Intergenic
1104924314 12:132306072-132306094 TCCCCACAGGCTCCCAGGTGAGG - Intronic
1106025733 13:25953728-25953750 TCCCCTGTGCTTCCCGGGTGAGG - Intronic
1106138817 13:26993806-26993828 GCCCACCTGCCCACCAGGTGAGG + Intergenic
1106323305 13:28662625-28662647 TCCCCTCTGCACCCCATGTAAGG - Intronic
1106541061 13:30690526-30690548 TCCCCTCTGCTCCCTCAGTGAGG - Intergenic
1107424243 13:40276779-40276801 TCCTCTCTGTCCCACAGGAGAGG - Intergenic
1108230945 13:48339607-48339629 CCCCCTGTGCTTCCCAGGTGAGG + Intronic
1108642361 13:52394834-52394856 TCCCCTCTGCACAGCAGATGGGG - Intronic
1108723859 13:53160095-53160117 CTCGCTCTGCCACCCAGGTGGGG + Intergenic
1109062062 13:57632399-57632421 TTCCCTCTGCACCCGAGCTGCGG - Exonic
1110716500 13:78710738-78710760 TCTTCTCTGCCCCCAAGGAGTGG - Intergenic
1112273097 13:97988495-97988517 TAACCTCTGCCAGCCAGGTGCGG + Intronic
1112562464 13:100526503-100526525 CCCCCTCTGGCCCCCCCGTGTGG - Intronic
1112788146 13:102974313-102974335 TCACCTGTGCACCTCAGGTGTGG + Intergenic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113737613 13:112689854-112689876 TGCCCTCTGCCCCCAGGGTCTGG + Intergenic
1113798676 13:113075209-113075231 ACCCCACTCCCCCCCAGCTGCGG + Intronic
1113799340 13:113078309-113078331 TCCCCTCTGACCCTCTGGAGAGG - Intronic
1113912221 13:113848166-113848188 TCCCCTCAGTTCCCCGGGTGGGG - Intronic
1115277145 14:31621554-31621576 TCCCTTGTGCTTCCCAGGTGAGG + Intronic
1115318304 14:32050311-32050333 TCCCCTCTGGCACCCTGGTGTGG + Intergenic
1116473678 14:45315437-45315459 TTCTCTCTGCCCTACAGGTGTGG - Intergenic
1120618185 14:86733064-86733086 TCCCCTCTTCACACCAGGTCCGG + Intergenic
1120786400 14:88541622-88541644 TCCCCTCTGTCCCCCCTGAGAGG + Intronic
1120931798 14:89856267-89856289 TACCCTCTGCCTCCCAGGTTTGG + Intronic
1121243039 14:92443482-92443504 GCCCCTCTGCCCCCAAGGTCAGG + Intronic
1121797905 14:96750956-96750978 ACCCCTCTGCCCCACTGCTGGGG + Intergenic
1122013164 14:98770360-98770382 TCCCCACTGCCTCCCACCTGAGG + Intergenic
1122215274 14:100199591-100199613 TTCCCTCTGCTGCCCAGGTTGGG + Intergenic
1122804766 14:104250700-104250722 CCCTCACTGCCCCCCGGGTGAGG - Intergenic
1122955146 14:105066985-105067007 CCTCCTCTGCGCCCCCGGTGAGG + Intergenic
1123185390 14:106511730-106511752 TCCCATCTGCCACACAGGAGTGG + Intergenic
1124372499 15:29111599-29111621 GCCCTTCAGGCCCCCAGGTGCGG + Intronic
1124412925 15:29451623-29451645 TCCCCTCTGCCCACCACGGGAGG + Intronic
1125549730 15:40536487-40536509 TCCATTCTGCATCCCAGGTGGGG + Intronic
1126239454 15:46425115-46425137 CCCCTTGTGCTCCCCAGGTGAGG - Intergenic
1126971009 15:54111768-54111790 TCCTCTCTGCCCCCTTGGAGTGG - Intronic
1127258862 15:57313228-57313250 TCCCCTCCTCTTCCCAGGTGTGG - Intergenic
1128228477 15:66018964-66018986 TCTGCTCTGCCCCCCAGATGGGG + Intronic
1128371035 15:67039569-67039591 TCCCCTCTGCTCCCCCGCTGAGG - Intergenic
1128514297 15:68332538-68332560 TTCCCTCTGCCCGCGAGGCGAGG - Intronic
1129600650 15:76996386-76996408 ACCCCTCTGCCCCTCAGCTCTGG + Intronic
1130132168 15:81153295-81153317 TCCCCACTTCTCCCCAGGAGAGG - Intergenic
1130386138 15:83414101-83414123 GCCCCTTTGCCCACCAGGTGGGG - Intergenic
1130810883 15:87377421-87377443 TCCCTTGTGCTTCCCAGGTGAGG - Intergenic
1132404335 15:101533294-101533316 CCCCCTCTGCTCCCCAGGGCTGG - Intergenic
1132467584 16:84590-84612 TTCCCTCTGCCCTGCAGGTTTGG - Intronic
1132887042 16:2186879-2186901 TGCCCAGTGCCCCCCAGTTGCGG + Intronic
1132984299 16:2756317-2756339 TCCCCGCTCCCCCTCAGGAGCGG + Exonic
1132994344 16:2815251-2815273 TCCTCCCTGCCCTCCAGGTGTGG + Intergenic
1132996683 16:2827176-2827198 TCCTCCCTGCCCTCCAGGTGTGG - Intergenic
1133235627 16:4386145-4386167 TCCCCTCTGCCCCCGAGCCCTGG - Intronic
1133284888 16:4686086-4686108 TGCGCTCTGCCTCCCAGCTGTGG + Intronic
1133738705 16:8635151-8635173 TGTCCTCTTCCCTCCAGGTGTGG + Exonic
1134548545 16:15128174-15128196 GCCCCTCTGCCCCCGCGTTGGGG - Intronic
1135265844 16:21024696-21024718 TCCTCTGTGCTTCCCAGGTGTGG - Exonic
1135465453 16:22681061-22681083 TCCTTTCTACCACCCAGGTGGGG + Intergenic
1135588383 16:23688599-23688621 TCCCCTCTGCTCCACACATGTGG - Intronic
1135696363 16:24590486-24590508 TCCCCCCTCCCCCCGAGATGTGG - Intergenic
1136040220 16:27572689-27572711 TCCCCTCTGTCCACCCAGTGGGG - Intronic
1136065342 16:27754686-27754708 TCCACTCTGCCCCGGGGGTGGGG + Intronic
1136502206 16:30677549-30677571 ACCCCTCTGGCCTCCTGGTGGGG + Intergenic
1136550735 16:30981044-30981066 TCCCTTCTGCCCCCCAGTTCCGG + Exonic
1136930829 16:34416625-34416647 CCCCCTGTGCTTCCCAGGTGAGG + Intergenic
1136973744 16:34995183-34995205 CCCCCTGTGCTTCCCAGGTGAGG - Intergenic
1137275973 16:46933739-46933761 GTCACTCTGCCCCCCAAGTGGGG + Intergenic
1137729240 16:50677621-50677643 TTCCCTCTGCCTGCCAGGAGGGG - Intronic
1137869352 16:51934461-51934483 TCCCCCATTCCCCCCAGGAGAGG - Intergenic
1138431263 16:56970665-56970687 TCCCTTCTGCCTTCCAGGTTTGG - Intronic
1138587099 16:57977798-57977820 AACCCTCTGCCCCCCAGCTATGG + Exonic
1138722301 16:59096612-59096634 TCCCTTGTGCTTCCCAGGTGAGG - Intergenic
1140378194 16:74462349-74462371 GCCCCTTAGCCCCCCAGGTTCGG + Intronic
1141138277 16:81480854-81480876 TCCCCTTGGCCCTCCTGGTGGGG + Intronic
1141454493 16:84131140-84131162 TCTGCTCTGCTCCCCAGGCGGGG + Exonic
1141701618 16:85645024-85645046 CACCCTCTGCCCCTGAGGTGAGG + Intronic
1141935145 16:87233590-87233612 TGCCCCCTGCACCCCATGTGTGG - Intronic
1142195214 16:88736464-88736486 CCCCCTCTGCCGCGCAGGTGTGG - Intronic
1142195231 16:88736525-88736547 CCCCCTCTGCCGCGCAGGTGTGG - Intronic
1142195248 16:88736586-88736608 CCCCCTCTGCCGCGCAGGTGTGG - Intronic
1142292523 16:89199562-89199584 CCCCCGCTGCCCACCAGGTTTGG - Exonic
1142375998 16:89707424-89707446 TCCCCTCTGACCCCTAGAAGGGG - Exonic
1143125479 17:4638967-4638989 TCCTTCCTGCCCCACAGGTGGGG - Exonic
1143325449 17:6095404-6095426 TCGCCTCTGTCCACCATGTGAGG + Intronic
1143376476 17:6470453-6470475 ACCCCGCTGCCCCTCGGGTGAGG - Intronic
1143407146 17:6685240-6685262 TCCACTCTGGGCCTCAGGTGAGG + Exonic
1143711877 17:8741282-8741304 TCCCCAGTGCCCCCCAGGGCTGG + Intronic
1145244858 17:21262101-21262123 ACCGCTCTGCCCTCCATGTGGGG + Intergenic
1145373255 17:22324553-22324575 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1145977616 17:28993346-28993368 TACCCACTGGCCCCAAGGTGGGG + Intronic
1146957651 17:36946191-36946213 CCACCTCTGGCCCCGAGGTGCGG + Intergenic
1147896502 17:43755148-43755170 CCCCCTCAGCCCGCCAGCTGAGG - Exonic
1148806297 17:50265644-50265666 TCCCCAAGGCCCCCCAGGGGAGG + Intergenic
1149571455 17:57675206-57675228 TCTCCTCTGCCCCCGATGTTGGG - Intronic
1150461364 17:65356495-65356517 TCCAGTCTGGCCCCCAGGAGAGG + Intergenic
1151821066 17:76497189-76497211 TCTCCTCTGCCTCCCCCGTGTGG - Intronic
1151966629 17:77434875-77434897 TCCCCTCTTCCCTCCAGCTATGG - Intronic
1152286028 17:79413840-79413862 TCCCATCTGCACCTCAGCTGGGG + Intronic
1152326730 17:79645808-79645830 CCCCATCTGCCTGCCAGGTGAGG - Intergenic
1152639770 17:81444651-81444673 TGCCCTCTGCCTCCCAGGCCTGG + Exonic
1153622053 18:6988774-6988796 TCTCCTCTGTCTCCCAGGTTGGG - Intronic
1153662030 18:7333630-7333652 TCCCCTCTTCTCACCAAGTGGGG - Intergenic
1155889999 18:31255750-31255772 TCCCCCATGCTCCCCAGGAGCGG + Intergenic
1157123461 18:44933884-44933906 CCCCTTATGCCTCCCAGGTGAGG + Intronic
1157544701 18:48539501-48539523 TCCCCTCCTCCCCCTCGGTGGGG + Intronic
1160174094 18:76579114-76579136 TCCCCTCCAGCCCTCAGGTGTGG - Intergenic
1160546242 18:79657829-79657851 TCCCAGCTGCGGCCCAGGTGAGG + Intergenic
1160693750 19:472590-472612 TCCCCTCTCCCTCCATGGTGAGG + Intronic
1160822589 19:1065431-1065453 TCCCCGCGGCCCCGCAGGGGAGG - Exonic
1162019321 19:7861509-7861531 TGCCCTCTGGCCCCCAGGCCAGG - Intronic
1162921674 19:13906617-13906639 TCCCCGCCTCCCCCCAGGTGAGG + Intronic
1162932707 19:13965375-13965397 TCTCCTCTGCTCCCCAGGGGCGG - Intronic
1162971121 19:14182136-14182158 TCCTCTCTGCCCCTCAGGGGAGG - Intronic
1163216918 19:15885860-15885882 TTGGCTCTGCTCCCCAGGTGGGG - Intronic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1163488800 19:17605409-17605431 TCCCCTCGGCCCCCAGGGTTTGG + Exonic
1163526230 19:17823179-17823201 TCCCCCCTGCCCCCCAGAAAAGG - Intergenic
1163737491 19:18990343-18990365 GCCCCTTGGCCCTCCAGGTGAGG - Intergenic
1163847964 19:19647754-19647776 ACCCTCCTGCCCCCCAGGTGTGG - Exonic
1164090951 19:21951849-21951871 CCCCTTGTGCCTCCCAGGTGAGG - Intronic
1164716183 19:30392062-30392084 TCTCCTCTGGCCCCCAGCTCCGG - Intronic
1165570313 19:36770287-36770309 TCCCCTCCACTCCCCAGGGGTGG + Intronic
1166109139 19:40612056-40612078 TCTCCCCTGCCCCCCAGATGTGG + Exonic
1166359605 19:42247689-42247711 CCCCCTCTGCCTCCCAGCTGGGG - Exonic
1166365865 19:42278204-42278226 TCCCGCCTGCTCCCCAGGAGAGG + Intronic
1166390869 19:42408116-42408138 CCCCTTCTGACCCCTAGGTGTGG - Exonic
1167166471 19:47802975-47802997 TCCCCTCTGCCCCCCAGGTGTGG - Exonic
1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG + Intergenic
1167471905 19:49680178-49680200 TCCCCTCCCCTCCCCAGCTGTGG + Intronic
925066557 2:932425-932447 TCCACAATGCCCCCCAGGGGCGG - Intergenic
925066574 2:932477-932499 TCCGCAATGCCCCCCAGGGGCGG - Intergenic
925697374 2:6595161-6595183 TCCCCTGAGACTCCCAGGTGGGG - Intergenic
926128170 2:10284577-10284599 GCCCCTCTGCCATCCTGGTGCGG + Intergenic
927915081 2:26930430-26930452 TCCGCCCTGCCCCCCAGGTTGGG - Intronic
928464059 2:31503704-31503726 TATCTTCTGCCTCCCAGGTGAGG - Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932589293 2:73054202-73054224 TCCCCACTGTACCCCAGTTGGGG - Intronic
932621020 2:73265063-73265085 GCCCCCCTGCCCCCCAGATGTGG + Intronic
936066368 2:109335440-109335462 TCCTCTCTGCCCCTCAGGGCTGG + Intronic
937872782 2:126797977-126797999 TCCCCAGAGCCCCTCAGGTGAGG + Intergenic
937907198 2:127058141-127058163 ACACCCCTGCCCACCAGGTGGGG + Intronic
938128286 2:128690234-128690256 CCCTCTCTGCCCCCCAGCTCCGG - Intergenic
943611847 2:190044210-190044232 TCCTCTCTGCCTCCAAGCTGGGG - Intronic
943692115 2:190880350-190880372 TCGCATCTGGCCCCCAGGTCAGG - Intergenic
945141104 2:206686938-206686960 TCCACTCTGCTCCTCAGGAGGGG - Intronic
946276557 2:218636029-218636051 TCCACACTGCCTCCCATGTGGGG - Intronic
946373582 2:219295012-219295034 TGCCCTCTGCCGGCCAGCTGAGG + Exonic
946393267 2:219429378-219429400 CACCCTCTATCCCCCAGGTGGGG + Intergenic
946846953 2:223867938-223867960 TGCCCTCTGCCCCCAAGATGAGG + Intronic
948157370 2:235794118-235794140 TCCCTTCTGACCCCATGGTGAGG + Intronic
948466095 2:238152241-238152263 GCCCCTCTGGTCCCCAGGGGCGG - Exonic
948797255 2:240411440-240411462 TCCCGTGTCCTCCCCAGGTGGGG - Intergenic
1168983656 20:2028710-2028732 TCTCCTCTGCTCCCTCGGTGGGG - Intergenic
1169189375 20:3648153-3648175 TGCCCTCTTTCCCCCAGGAGGGG + Exonic
1169214217 20:3784302-3784324 TCCCCTCTGCCATCCACGTCAGG - Exonic
1169270533 20:4195784-4195806 TGCCATCTGCCGCCCAGATGGGG + Intergenic
1169360707 20:4946393-4946415 TCCTCTCTGGCCCACTGGTGAGG - Intronic
1170494650 20:16913363-16913385 TCCCTTGTGCCTCCCGGGTGAGG + Intergenic
1171374927 20:24685899-24685921 TGCCCTCTGCCCCCACCGTGTGG + Intergenic
1171529538 20:25843774-25843796 TCCCCTCCACTCCCCAGGGGTGG + Intronic
1171547288 20:26012106-26012128 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1172033578 20:31997256-31997278 GCCCCTCTGTCCGCAAGGTGCGG - Exonic
1173586467 20:44186811-44186833 TCACCACTGCACCCCAGGAGGGG + Exonic
1173792230 20:45834968-45834990 GCCCCACTGCCCATCAGGTGGGG - Exonic
1175192891 20:57223464-57223486 ACCCATCTGAGCCCCAGGTGAGG + Intronic
1175245892 20:57581698-57581720 TCCTCTCTGCCCCCGACCTGTGG - Intergenic
1175381844 20:58569005-58569027 TTCCTTCTGCCACCCAGGAGAGG + Intergenic
1175503461 20:59466335-59466357 TGACCTCTGCCCTCCAGGGGAGG + Intergenic
1175697313 20:61112151-61112173 CCCCCTCCGCCCCAGAGGTGGGG - Intergenic
1175712970 20:61235732-61235754 TCCACTCTGACCTCCAGTTGTGG + Intergenic
1176009961 20:62887904-62887926 GCCCCTCTGCCCCGCAGTGGGGG - Intronic
1176091615 20:63320881-63320903 TCGCCCCTGCCTCCCAGGTGCGG + Intronic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1176247510 20:64104478-64104500 TCCCCTGTACCCCCCTGCTGTGG - Intergenic
1176247585 20:64104762-64104784 TCCCCTGTGCCCCCCTGCTGTGG - Intergenic
1176247599 20:64104811-64104833 TCCCCTGTACCCCCCTGCTGTGG - Intergenic
1176915526 21:14621351-14621373 TCCCTTGTGCTTCCCAGGTGAGG - Intronic
1179376284 21:40852686-40852708 TCCTCCCTGCCCTCCAGATGCGG + Intergenic
1179902818 21:44402711-44402733 GCCAAGCTGCCCCCCAGGTGGGG + Intronic
1179979925 21:44890566-44890588 TCCCCACTGGCCACCATGTGGGG - Intronic
1180569373 22:16701148-16701170 TGCCCACTGCCCTCCAGGTGAGG - Intergenic
1180800423 22:18629252-18629274 CCCCCTCTGTCCCCCAGGTGCGG - Intergenic
1180851657 22:19024808-19024830 CCCCCTCTGTCCCCCAGGTGCGG - Intergenic
1180938868 22:19643906-19643928 TCCCATCAGCCCCCAGGGTGGGG + Intergenic
1181015397 22:20065834-20065856 CTCCCTCTTCCCTCCAGGTGAGG + Exonic
1181177794 22:21047627-21047649 TCCCATCTGTCTCCCAGATGTGG - Intronic
1181221296 22:21366010-21366032 CCCCCTCTGTCCCCCAGGTGCGG + Intergenic
1181522514 22:23457725-23457747 ACCGCACTGCCCTCCAGGTGGGG - Intergenic
1182316918 22:29453886-29453908 TCTCCTCTGCCCCCCGGGGAGGG - Intergenic
1182911251 22:33986520-33986542 TCTCCCCTGCCCCCCAAATGAGG - Intergenic
1183257214 22:36770366-36770388 GCCCCTCTGCCCCCCGAGTGTGG + Intronic
1183905565 22:41037706-41037728 TCACCTCTGCAGTCCAGGTGGGG + Intergenic
1184066503 22:42124658-42124680 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184068971 22:42136810-42136832 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184566180 22:45293431-45293453 TACCCTCTGCCCCGCGGGTGGGG + Intronic
1184860353 22:47169982-47170004 GCCCCTCTGCCTGCCTGGTGTGG + Intronic
1185332687 22:50258744-50258766 TCCCCTCAGCACCCCTGGTTGGG + Intronic
949428168 3:3941825-3941847 CCCCCTGTGCTTCCCAGGTGAGG + Intronic
950125180 3:10506108-10506130 GCCCCTTTGCCCCCCAGGTCTGG - Intronic
950169999 3:10832292-10832314 TCCCCAGTGCCTCCCTGGTGGGG - Intronic
950262892 3:11554973-11554995 CCCCCTCTGCTGCCCAGGAGTGG + Exonic
950446933 3:13043891-13043913 TCCCCACTCCCCCTCAGATGAGG + Intronic
950683587 3:14601827-14601849 TCCAGTCTGCCCCCCAGGTTGGG - Intergenic
950706233 3:14784259-14784281 TCTCCTCTGGCCCCCAGCTCAGG + Intergenic
952287180 3:31980724-31980746 TCCCTGCTCCCCTCCAGGTGGGG - Intronic
952946493 3:38481214-38481236 TCACCTCTGCACCCCAGGTAGGG + Intronic
953161764 3:40427255-40427277 TCTCCTCTACTCCACAGGTGGGG + Exonic
953254624 3:41277993-41278015 CCCCTTGTGCCTCCCAGGTGAGG - Intronic
953782540 3:45884415-45884437 TCCTCTCTGCATCCCAGGAGAGG + Intronic
953867320 3:46595564-46595586 TCCACTCTGCAGCCCAGGGGTGG - Intronic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
954409290 3:50363385-50363407 TCCCCACTGGCCCCCAGGCTGGG + Intronic
954613823 3:51959571-51959593 TTCTCTCTGCCAACCAGGTGAGG - Exonic
954628593 3:52036175-52036197 TCCCCCCTGTCCTCCAGCTGGGG + Intergenic
956121249 3:65967924-65967946 TCCTCCTTGACCCCCAGGTGTGG - Intronic
956168526 3:66414363-66414385 CTCGCTCTGTCCCCCAGGTGGGG - Intronic
959278144 3:104304187-104304209 CCCCTTCTGCCTCCCAGGTGAGG - Intergenic
960640032 3:119815423-119815445 CTCCCTCTTCTCCCCAGGTGAGG + Exonic
961132453 3:124481787-124481809 TCACCTCTTAGCCCCAGGTGAGG + Intronic
961594539 3:128006398-128006420 TCCCGCCTGCCTCCCAGCTGGGG - Intergenic
961696642 3:128709724-128709746 TGCCCTCTGCCTCCCTGGAGAGG - Intergenic
962748332 3:138414234-138414256 CCCCCTCTGCCTCCCTTGTGGGG + Intergenic
963068357 3:141281641-141281663 TCCCCTCCCTGCCCCAGGTGGGG - Intronic
963202777 3:142601640-142601662 CCGCCTCAGCCTCCCAGGTGTGG + Intronic
964841585 3:160999438-160999460 TTCCCTCTGGCGGCCAGGTGGGG - Intronic
966291115 3:178360986-178361008 TCCCTTGTGCTTCCCAGGTGAGG - Intergenic
966648408 3:182271788-182271810 TGCCCTCTGGCAGCCAGGTGGGG + Intergenic
966781990 3:183591898-183591920 ACCCCTCTCCCCCAAAGGTGGGG + Intergenic
968603800 4:1522136-1522158 TCCCCTTTGTCCCTGAGGTGAGG + Intergenic
968908667 4:3465914-3465936 TCTCTTCTTCCTCCCAGGTGCGG + Intronic
969067577 4:4499967-4499989 TCACCTCTGCCCCCATGGTGAGG - Intronic
969118456 4:4889266-4889288 TCCCCTCTTTCCACCATGTGAGG + Intergenic
969644052 4:8416224-8416246 TCCTCTCTGCACCCCAGGACAGG - Intronic
971697814 4:29929491-29929513 GCCCCTATGCTTCCCAGGTGAGG - Intergenic
972317925 4:37944769-37944791 TCCCTTGTGCTTCCCAGGTGAGG + Intronic
972506935 4:39728666-39728688 CTCGCTCTGTCCCCCAGGTGGGG + Intronic
973298912 4:48558421-48558443 TTCCCTCTGCCCCCAAGCTCTGG - Intronic
974491709 4:62572181-62572203 CCCCTTGTGCTCCCCAGGTGAGG + Intergenic
977974092 4:103244008-103244030 CCCCCTGTGCTTCCCAGGTGAGG + Intergenic
978956243 4:114616534-114616556 CCCCCTGTGCTTCCCAGGTGAGG + Intronic
979946977 4:126844118-126844140 GCTCCTTTGCCCCCCAGGTGAGG + Intergenic
980092038 4:128453191-128453213 TCCCCTCCCCCACCCAGGGGAGG - Intergenic
984712526 4:182897759-182897781 TCTCCTCAGCCCCGCAGGTGCGG - Intronic
984927227 4:184817628-184817650 GTCCCTCTGCCTCCCAGGTGTGG - Intronic
985692826 5:1323151-1323173 TGGCCTCTGCTGCCCAGGTGGGG - Intronic
985801819 5:2009429-2009451 TCCCCTCTGCACATCAGATGCGG - Intergenic
985823903 5:2178941-2178963 TCACCTCTCCCCTCCAGGGGAGG - Intergenic
985996218 5:3598720-3598742 TCCTCTCTGCCACCCAGAGGGGG - Intronic
988067715 5:26243033-26243055 TGCCCTCTTCCCACCATGTGGGG - Intergenic
989363865 5:40634346-40634368 CCCCTTGTGCCTCCCAGGTGAGG - Intergenic
990479264 5:56192483-56192505 CCCTCTCTGCCCCCCAGGAGGGG + Intronic
990533984 5:56701785-56701807 TCTCCTCTACCCCCCACTTGAGG + Intergenic
990615909 5:57508245-57508267 GCCCCTCTGCCCCCCATCTAGGG + Intergenic
990985487 5:61637717-61637739 TCCTCTCTGTGCCCCATGTGAGG - Intronic
992093834 5:73342244-73342266 TGCCCCCTGCCTCCCAAGTGAGG - Intergenic
994112725 5:96025306-96025328 TCCCTGCTTCCCACCAGGTGAGG - Intergenic
994221878 5:97205723-97205745 CTACCTCTGCCCCCCAGTTGTGG + Intergenic
997137715 5:131344207-131344229 TCCCCTGCGCTTCCCAGGTGAGG - Intronic
997434895 5:133866985-133867007 ACCGCTCAGCCCTCCAGGTGGGG + Intergenic
998400206 5:141844801-141844823 TGCCCTCTGCCCACAAGGTCTGG - Intergenic
999194730 5:149774218-149774240 TCCCCTGTTCCCCCCTAGTGAGG + Intronic
1001014583 5:168128541-168128563 GCCCCTCTGTCCCCCAGATGTGG - Intronic
1001232291 5:169998968-169998990 TCACCTCTGGCCCCTAGGTATGG - Intronic
1001480036 5:172082225-172082247 ACCCCTCTGCTGCCAAGGTGAGG + Intronic
1003423771 6:5982763-5982785 TCCCCTCTGTCACCCAGGCTAGG - Intergenic
1003618631 6:7677744-7677766 TCCCCCCTGCCCCCCACTTCTGG + Intergenic
1003948250 6:11094297-11094319 GCCCTTCTGCCCCCAAGATGTGG + Exonic
1005955347 6:30659710-30659732 TCCCCTCTCCCCACCATGTCAGG + Intronic
1006030531 6:31173815-31173837 CCACCTCTCCCCACCAGGTGAGG + Intronic
1006792660 6:36714097-36714119 TCCCCTCTGCCCCTCCAGGGAGG + Intronic
1006835896 6:36998735-36998757 ACCCATCTGCCCCCCACGTCAGG + Intergenic
1007638416 6:43315581-43315603 CCCCCTCTACCCTCCAGGAGAGG - Intronic
1011174024 6:84540681-84540703 CCCCCTGTGCTTCCCAGGTGAGG - Intergenic
1012597961 6:101062179-101062201 CCCCCTGTGCTTCCCAGGTGAGG - Intergenic
1012879290 6:104766146-104766168 TCCCCACTGTGCCCCACGTGGGG - Intronic
1013142571 6:107352774-107352796 ACCCCTCCACCCCCAAGGTGTGG - Intronic
1016422086 6:143896089-143896111 TGCTCTCTGCCCCTCTGGTGGGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1017954759 6:159169061-159169083 ACACCTCTGCGCCCCAAGTGGGG - Intergenic
1018058307 6:160070988-160071010 TCACCTTTGCCCCCCACATGTGG - Intronic
1018384596 6:163291217-163291239 TCCCCTCTGCCCGCCAGAGCTGG + Intronic
1019078698 6:169412496-169412518 TCTCCTCTTCCCCCCACCTGGGG + Intergenic
1019124869 6:169831370-169831392 TCCTCTCTGGCCCCCAGTTAAGG + Intergenic
1019283504 7:211925-211947 TCACCGCCGCCCCCCAGGTCAGG + Intronic
1019394621 7:810832-810854 TCTCCTGGGCCCTCCAGGTGTGG + Intergenic
1019480384 7:1264077-1264099 CCCACCCTGCCCGCCAGGTGTGG - Intergenic
1019588819 7:1818842-1818864 ACCGCGCTGCCCTCCAGGTGGGG + Intronic
1019978615 7:4604786-4604808 TCTCCACGGCCCCCCACGTGGGG - Intergenic
1020330401 7:7011735-7011757 CCCCCTATGCTTCCCAGGTGAGG + Intergenic
1020347658 7:7182772-7182794 CCCTCTCCGCCCCCCAGGAGGGG + Exonic
1021825286 7:24544777-24544799 TCCCCTCAGCCCCTCTGCTGCGG - Intergenic
1022008912 7:26292117-26292139 TCCCCTGCACCGCCCAGGTGGGG + Exonic
1022113681 7:27245869-27245891 TCCGCTCCTCTCCCCAGGTGTGG + Exonic
1022198651 7:28094790-28094812 TCCCCTCTGGCCACAGGGTGGGG - Intronic
1022691174 7:32656772-32656794 TCCCTACTGTCCCCCAGGTCTGG + Intergenic
1024392515 7:48831715-48831737 TCCCCACTGGCCACCATGTGAGG + Intergenic
1024989835 7:55224435-55224457 CCACCTCTGCACCCCAGGTGGGG + Intronic
1027560578 7:79724035-79724057 TACTCTCTGCCTCCCACGTGGGG + Intergenic
1028505372 7:91564810-91564832 TCCCTTCTCTCCCCCATGTGTGG + Intergenic
1029908056 7:104112126-104112148 TCCACTCTGTCGCCCAGGTTGGG - Intergenic
1032425072 7:131815974-131815996 TGCCCTCTATTCCCCAGGTGAGG + Intergenic
1034422465 7:150996746-150996768 ACCCCTCTCCTCCCCAGGAGCGG + Exonic
1034497482 7:151431360-151431382 TCCCCTCTGCCCCTCAAGGGTGG + Intronic
1034517757 7:151594028-151594050 TCCCCAGGGACCCCCAGGTGTGG - Intronic
1034967486 7:155400189-155400211 GCCCCTCAGTCACCCAGGTGAGG - Intergenic
1035624641 8:1061733-1061755 TTCCCTCTCCCTCCCCGGTGAGG + Intergenic
1035735155 8:1882220-1882242 TTCCCACTGCACCCCATGTGGGG - Intronic
1035737447 8:1898741-1898763 TCCCCTCTGTCCCCCAAGGCTGG - Intronic
1035781915 8:2234264-2234286 GTCCCTCTGCTCCCCTGGTGCGG - Intergenic
1036896541 8:12640691-12640713 TCCCCTCCTCCCCACAGGAGGGG + Intergenic
1038416224 8:27397886-27397908 TCACCTCTTCCACCCAGGGGTGG - Intronic
1038499379 8:28030699-28030721 TCTCCTCTGCCCCCCAGAGAGGG - Intronic
1039103714 8:33967729-33967751 TCCCTTGTGCTTCCCAGGTGAGG + Intergenic
1042171775 8:65998714-65998736 CCCCCTGTGCTTCCCAGGTGAGG + Intergenic
1043938905 8:86174328-86174350 CCCCTTCTGCTTCCCAGGTGAGG + Intergenic
1045104933 8:98883226-98883248 TCCCCTCTCCCCCTTAGCTGTGG - Intronic
1045802521 8:106117906-106117928 CCCCCTGTGCTTCCCAGGTGAGG + Intergenic
1047037438 8:120955301-120955323 TCCCCTTTACACCCAAGGTGTGG + Intergenic
1047413299 8:124641905-124641927 TCCCCTCTTCCCGCCAATTGTGG + Intronic
1048471915 8:134711785-134711807 TCCCCTCTGCACGCCAGGCAGGG - Intronic
1049204202 8:141355814-141355836 TCCTCTCTGCCCCCGGGGGGAGG + Intergenic
1049272351 8:141702667-141702689 TCCCCACTGCCCTTCAGGTGTGG + Intergenic
1049533863 8:143169114-143169136 TTCCCTCTGACCCCCAGATCAGG + Intergenic
1049579494 8:143404867-143404889 TTGCCTCTGCCACCCAGCTGGGG + Intergenic
1049583526 8:143423037-143423059 CCTCCTCCGCCTCCCAGGTGAGG + Intronic
1049587290 8:143437930-143437952 GTCCCTGTGGCCCCCAGGTGAGG + Exonic
1049725224 8:144142658-144142680 TCACCTCTGCCGCCCAGGGCTGG - Intergenic
1049797413 8:144503053-144503075 GCCCCTCTGGCCCCCAGGCCGGG - Intronic
1050320669 9:4449020-4449042 CCCCTTGTGCCTCCCAGGTGAGG - Intergenic
1051882560 9:21854738-21854760 TAACATCCGCCCCCCAGGTGCGG - Exonic
1052991979 9:34523642-34523664 TTCCCTCTGCCACCTGGGTGTGG + Intergenic
1053797514 9:41740072-41740094 TCCCCTCCACTCCCCAGGGGTGG + Intergenic
1054147673 9:61574871-61574893 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1054185926 9:61952124-61952146 TCCCCTCCACTCCCCAGGGGTGG + Intergenic
1054467421 9:65505918-65505940 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1054652578 9:67636395-67636417 TCCCCTCCACTCCCCAGGGGTGG - Intergenic
1055964036 9:81847787-81847809 TCCGCTCTTCTCCCCATGTGAGG - Intergenic
1056000912 9:82215770-82215792 TCCCTTCTGCTTCCCGGGTGAGG - Intergenic
1056503422 9:87233230-87233252 TACCCTCTGCCCCCTAAATGAGG + Intergenic
1056601429 9:88050192-88050214 TCCACCCTGCTGCCCAGGTGTGG + Intergenic
1056832144 9:89925542-89925564 TCCACACTTCTCCCCAGGTGAGG - Intergenic
1057196167 9:93116504-93116526 TCCCGAGTGCCCCTCAGGTGTGG - Intergenic
1057345462 9:94246839-94246861 TCTCCTCTGGCACCCATGTGTGG - Intergenic
1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG + Intronic
1060828709 9:126700741-126700763 TCCCATGGGACCCCCAGGTGGGG - Exonic
1060958646 9:127663386-127663408 TCCCGTGTGTCCCCCAAGTGAGG + Intronic
1061136265 9:128735704-128735726 TCCCCTCTTCCCCACAGGCTGGG - Intronic
1061184048 9:129041771-129041793 CACCCTCTGCCCCCCAGGCCTGG - Intronic
1061673743 9:132203795-132203817 TTCCCTCTGACTCCCAGGTCTGG - Intronic
1062172669 9:135144184-135144206 TTCCCTCTGCCCCTCAAGCGGGG + Intergenic
1062408342 9:136408787-136408809 TGGCCCCAGCCCCCCAGGTGGGG + Intronic
1062609380 9:137367157-137367179 CCTCCTCTGCCCCACAGGTGAGG + Intronic
1186421163 X:9427786-9427808 TCACCTCCGCCTCCCAGGTTCGG + Intergenic
1190263527 X:48814579-48814601 CCACCTCTGCCCCCAAAGTGAGG + Intronic
1192064353 X:67865016-67865038 TCCCTTGTGCTTCCCAGGTGAGG + Intergenic
1193473884 X:81940424-81940446 CCCCCTGTGCTTCCCAGGTGGGG - Intergenic
1194771722 X:97915133-97915155 TCCCTTGTGCTTCCCAGGTGAGG - Intergenic
1197013595 X:121596963-121596985 TCTCCTCTGCCCTCCAGATCAGG + Intergenic
1199712203 X:150477407-150477429 TCCTCTCTGACCCCCAGGGGTGG + Intronic
1200115753 X:153769060-153769082 TCCTGACTGCCCACCAGGTGAGG + Exonic
1200123208 X:153800902-153800924 TCCCCTCTTCCCTGCTGGTGGGG + Intergenic
1200210366 X:154344379-154344401 TCCCCTCTCTGCCCCAGGTGGGG + Intergenic
1200212780 X:154354286-154354308 GCCCCACTGCCCCACAGGGGAGG - Exonic
1200220486 X:154387713-154387735 TCCCCTCTCTGCCCCAGGTGGGG - Intergenic
1200714423 Y:6520870-6520892 GCCCCTCTGCGGTCCAGGTGGGG - Intergenic
1201019400 Y:9640286-9640308 GCCCCTCTGCGGTCCAGGTGGGG + Intergenic
1201776187 Y:17668522-17668544 CCCCCTGTGCTTCCCAGGTGAGG + Intergenic
1201825369 Y:18237470-18237492 CCCCCTGTGCTTCCCAGGTGAGG - Intergenic
1202343097 Y:23889654-23889676 TCCCTTTTGCATCCCAGGTGGGG - Intergenic
1202527671 Y:25780431-25780453 TCCCTTTTGCATCCCAGGTGGGG + Intergenic