ID: 1167175372

View in Genome Browser
Species Human (GRCh38)
Location 19:47860785-47860807
Sequence TCCCCTCTGCCCCCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167175362_1167175372 16 Left 1167175362 19:47860746-47860768 CCCGGGCCGCGCGAGTCCCTCCT No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175365_1167175372 0 Left 1167175365 19:47860762-47860784 CCCTCCTTCACACCTTCTCCCTG No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175361_1167175372 28 Left 1167175361 19:47860734-47860756 CCGAGCGGCTCACCCGGGCCGCG No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175363_1167175372 15 Left 1167175363 19:47860747-47860769 CCGGGCCGCGCGAGTCCCTCCTT No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175360_1167175372 29 Left 1167175360 19:47860733-47860755 CCCGAGCGGCTCACCCGGGCCGC No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175367_1167175372 -4 Left 1167175367 19:47860766-47860788 CCTTCACACCTTCTCCCTGTCCC No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175359_1167175372 30 Left 1167175359 19:47860732-47860754 CCCCGAGCGGCTCACCCGGGCCG No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175364_1167175372 10 Left 1167175364 19:47860752-47860774 CCGCGCGAGTCCCTCCTTCACAC No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data
1167175366_1167175372 -1 Left 1167175366 19:47860763-47860785 CCTCCTTCACACCTTCTCCCTGT No data
Right 1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167175372 Original CRISPR TCCCCTCTGCCCCCCAGGTG TGG Intergenic
No off target data available for this crispr