ID: 1167178497

View in Genome Browser
Species Human (GRCh38)
Location 19:47883128-47883150
Sequence GGGGCAGTCAACCTGGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167178491_1167178497 -9 Left 1167178491 19:47883114-47883136 CCAGTCCTGGCCCCGGGGCAGTC 0: 1
1: 0
2: 1
3: 20
4: 234
Right 1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG 0: 1
1: 0
2: 1
3: 4
4: 68
1167178490_1167178497 -8 Left 1167178490 19:47883113-47883135 CCCAGTCCTGGCCCCGGGGCAGT 0: 1
1: 0
2: 3
3: 29
4: 229
Right 1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG 0: 1
1: 0
2: 1
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167178497 Original CRISPR GGGGCAGTCAACCTGGATAC AGG Intronic
901184324 1:7362705-7362727 GAGGCAGTGAACTTGGATAGAGG + Intronic
903136994 1:21315909-21315931 GAGTCAGTCAACCTGGGTACCGG + Intronic
913453457 1:119008049-119008071 GTGGCAGCGAAGCTGGATACGGG - Intergenic
914717065 1:150262180-150262202 GGGGAAGTCCACCCAGATACAGG - Exonic
915169069 1:153964994-153965016 GGGTCAGGAAACCTGGATTCTGG + Intronic
915318656 1:155043940-155043962 GGGGCAGCCCAGCTGGACACTGG - Intronic
916787946 1:168099708-168099730 GGGGCAGTGAAGCTGGGTGCTGG + Intronic
1066101273 10:32120919-32120941 GGGGTAGTCAAACTGGTTGCTGG - Intergenic
1069122617 10:64586347-64586369 TGGCCAGGCAACCTGGATATAGG + Intergenic
1069842280 10:71347328-71347350 GGGACCGGCAACCTGGGTACTGG + Intronic
1078422945 11:11227333-11227355 GGGGAAGGCAACCTGGGGACAGG - Intergenic
1085402214 11:76241822-76241844 GGGGCAGGCAACCTGGGCATGGG + Intergenic
1090536822 11:127651750-127651772 TGGGCAGTGTACCAGGATACTGG + Intergenic
1092896651 12:13018250-13018272 GGGGCAGTCACACTGGATTAGGG + Intergenic
1095599827 12:44001961-44001983 GGGGCAATCAGACTGTATACAGG + Intronic
1102781793 12:115571824-115571846 GGGGCAATAAACATGGACACAGG + Intergenic
1110422169 13:75324259-75324281 GGGACAGTCTACCTGAATTCTGG + Exonic
1117211871 14:53509255-53509277 TGGGCTGTGAACCTGGACACGGG + Intergenic
1117288804 14:54312602-54312624 TGGGGAGCCATCCTGGATACTGG - Intergenic
1121425928 14:93852067-93852089 GGGGCAGTCAGCCTGGTTATGGG - Intergenic
1130040536 15:80402825-80402847 GGAACAGTCAACTTTGATACGGG + Intronic
1131815532 15:96217516-96217538 GCGGCAGTAAACCTGGAGAAAGG - Intergenic
1134834067 16:17346703-17346725 GGGCCAGTGAACGTGGAGACTGG + Intronic
1140051097 16:71481907-71481929 GGGGCAGTGAAGATGGAAACAGG - Intronic
1143598069 17:7927580-7927602 AGGGAAGTGAACCTGGATAGGGG - Intronic
1146304934 17:31723635-31723657 GGGGCAGTCAGCCTGACTGCGGG - Intergenic
1161018718 19:1997530-1997552 GGGGTGGTCACCCAGGATACCGG - Intronic
1161981853 19:7634049-7634071 GGGGCAGGCAACCAGGCTCCAGG - Intronic
1162985292 19:14265743-14265765 GGGGCCGTCTACCTGGATTCTGG - Intergenic
1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG + Intronic
925084775 2:1099506-1099528 AGGGCACTCTACCTGCATACTGG - Intronic
930073580 2:47388971-47388993 GGGGAAGTCATCCTGGTGACAGG - Intergenic
933971101 2:87470264-87470286 TGAGCAGTCAACCTGGACGCAGG + Intergenic
936322627 2:111479925-111479947 TGAGCAGTCAACCTGGACGCAGG - Intergenic
936328254 2:111524009-111524031 GGGGCAGTGATCCGGGATGCAGG + Intergenic
937047349 2:118858852-118858874 GGGGCAGCCAACCAGCATGCCGG - Intergenic
937953741 2:127407979-127408001 GGGGCAGGCAACTCGGAGACGGG - Intergenic
939174296 2:138731677-138731699 GGGGAGGTCAACCTGCAGACAGG + Intronic
939548158 2:143579627-143579649 TGGGCAGTCTTCCTGGAAACAGG - Intronic
943126742 2:183803800-183803822 AGGCCAGCCAACCTAGATACAGG - Intergenic
944050010 2:195457070-195457092 GGGGCCGTCTGCCTGGATAAAGG + Intergenic
946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG + Intronic
1171019003 20:21568190-21568212 GGGCCAGGCATGCTGGATACTGG + Intergenic
1174746186 20:53065969-53065991 GCGGAAGTCAGCGTGGATACAGG - Intronic
1175223896 20:57433751-57433773 GAGCCAGTCAAGCTGGAGACAGG + Intergenic
1177712733 21:24800841-24800863 GGAGCAGTTAAACTGGACACCGG + Intergenic
1178530301 21:33370306-33370328 TGGGCAGTCAGCATGGAAACAGG + Intergenic
1184199348 22:42955349-42955371 GGGACAGTTCACCTGGATGCTGG - Intronic
1185368050 22:50445947-50445969 GGGGCAGAGAACCTGGCTAGAGG - Exonic
952865895 3:37854910-37854932 AGGGCAGTCAACCAGGGTCCTGG - Intergenic
954662431 3:52233197-52233219 GGGGCAGTCAGCCTGGCTGGGGG + Intronic
966207020 3:177415380-177415402 GGGGCAGATAACCTGGCAACTGG + Intergenic
968552888 4:1233068-1233090 TGGGCAGTCTGCCTGGAAACAGG + Intronic
969319165 4:6401179-6401201 GGGGCAGGCAAGCTGAATAACGG - Intronic
976577502 4:86691300-86691322 AGGGAAGTGAACCTGGATAAAGG + Intronic
979154429 4:117365233-117365255 GAGGCAGTCAACTTTGCTACTGG + Intergenic
979519793 4:121653016-121653038 AGGGCAGTCAACCAGGAGAAGGG + Intergenic
995190274 5:109312230-109312252 GGGACAGCCAACTTGGATCCAGG - Intergenic
1001515771 5:172354314-172354336 GGGGCAATAAACCGGGATAAGGG - Intronic
1001695737 5:173668321-173668343 GGGGCAGTCACCTTGGCTTCTGG + Intergenic
1001700631 5:173704308-173704330 GGGGCAGACAACTGGGATAGTGG - Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1037744027 8:21629187-21629209 GGGACAGGCAGCCTGGAGACAGG - Intergenic
1041909553 8:63073833-63073855 GGAGCAGTATACTTGGATACTGG + Intronic
1045875864 8:106979930-106979952 GAGGCATTTAACCTTGATACTGG + Intergenic
1047199153 8:122749266-122749288 GGGGCAGACAACCTAGAGAAAGG - Intergenic
1047348798 8:124053932-124053954 GGGGCAGCTAACTTGGATAGAGG - Intronic
1049755933 8:144311344-144311366 GGTGCAGTCAAACCGGATCCTGG + Exonic
1054800536 9:69344080-69344102 GGCTCAGACAACCTGGATGCAGG - Intronic
1060420760 9:123468045-123468067 GGGACAGTCCACCTGGGTACAGG - Intronic
1060529588 9:124340396-124340418 GTGGCTGCCAACCTGGACACCGG - Intronic
1061809145 9:133152332-133152354 GCTGCAGTGACCCTGGATACGGG + Intergenic
1185872149 X:3673345-3673367 GGGCCAGTCCACGAGGATACTGG + Intronic
1198058184 X:133016195-133016217 GTAGCAGTCTCCCTGGATACAGG + Intergenic