ID: 1167181123

View in Genome Browser
Species Human (GRCh38)
Location 19:47904245-47904267
Sequence AAGAAGCAAAGTGGACGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167181118_1167181123 -9 Left 1167181118 19:47904231-47904253 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167181123 19:47904245-47904267 AAGAAGCAAAGTGGACGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167181123 Original CRISPR AAGAAGCAAAGTGGACGGCC GGG Intergenic
No off target data available for this crispr