ID: 1167181791

View in Genome Browser
Species Human (GRCh38)
Location 19:47909605-47909627
Sequence AAGAAGCAAAGTGGACGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167181786_1167181791 -9 Left 1167181786 19:47909591-47909613 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167181791 19:47909605-47909627 AAGAAGCAAAGTGGACGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167181791 Original CRISPR AAGAAGCAAAGTGGACGGCC GGG Intergenic
No off target data available for this crispr