ID: 1167182440

View in Genome Browser
Species Human (GRCh38)
Location 19:47914995-47915017
Sequence AAGAAGCAAAGTGGACGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167182435_1167182440 -9 Left 1167182435 19:47914981-47915003 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167182440 19:47914995-47915017 AAGAAGCAAAGTGGACGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167182440 Original CRISPR AAGAAGCAAAGTGGACGGCC GGG Intergenic
No off target data available for this crispr