ID: 1167183103

View in Genome Browser
Species Human (GRCh38)
Location 19:47920333-47920355
Sequence TTGCTTCTTGCAGAGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167183103_1167183108 -9 Left 1167183103 19:47920333-47920355 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167183108 19:47920347-47920369 AAGAAGCAAAGTGGACGGCCGGG No data
1167183103_1167183107 -10 Left 1167183103 19:47920333-47920355 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167183107 19:47920346-47920368 CAAGAAGCAAAGTGGACGGCCGG No data
1167183103_1167183109 -4 Left 1167183103 19:47920333-47920355 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167183109 19:47920352-47920374 GCAAAGTGGACGGCCGGGCGCGG No data
1167183103_1167183113 26 Left 1167183103 19:47920333-47920355 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167183113 19:47920382-47920404 CTCCTGGAATCCCAGCACTTTGG 0: 57
1: 6647
2: 205337
3: 276775
4: 195543
1167183103_1167183110 -1 Left 1167183103 19:47920333-47920355 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167183110 19:47920355-47920377 AAGTGGACGGCCGGGCGCGGTGG No data
1167183103_1167183114 27 Left 1167183103 19:47920333-47920355 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167183114 19:47920383-47920405 TCCTGGAATCCCAGCACTTTGGG 0: 68
1: 8390
2: 306788
3: 272294
4: 152691
1167183103_1167183112 10 Left 1167183103 19:47920333-47920355 CCATCAGCCTCTGCAAGAAGCAA No data
Right 1167183112 19:47920366-47920388 CGGGCGCGGTGGCTCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167183103 Original CRISPR TTGCTTCTTGCAGAGGCTGA TGG (reversed) Intergenic
No off target data available for this crispr