ID: 1167188041

View in Genome Browser
Species Human (GRCh38)
Location 19:47961612-47961634
Sequence CTGGAAGAGCATCTTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167188041_1167188047 3 Left 1167188041 19:47961612-47961634 CCCACTGCAAGATGCTCTTCCAG No data
Right 1167188047 19:47961638-47961660 CAGGAAGTGGATTATGTTCTAGG No data
1167188041_1167188044 -10 Left 1167188041 19:47961612-47961634 CCCACTGCAAGATGCTCTTCCAG No data
Right 1167188044 19:47961625-47961647 GCTCTTCCAGTGCCAGGAAGTGG No data
1167188041_1167188048 14 Left 1167188041 19:47961612-47961634 CCCACTGCAAGATGCTCTTCCAG No data
Right 1167188048 19:47961649-47961671 TTATGTTCTAGGAGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167188041 Original CRISPR CTGGAAGAGCATCTTGCAGT GGG (reversed) Intergenic