ID: 1167188777

View in Genome Browser
Species Human (GRCh38)
Location 19:47967831-47967853
Sequence CAAGCAACACAGATGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167188777_1167188783 21 Left 1167188777 19:47967831-47967853 CCTACTTCCATCTGTGTTGCTTG 0: 1
1: 0
2: 1
3: 25
4: 233
Right 1167188783 19:47967875-47967897 CCCATAGAAAGGATATTGAAGGG 0: 1
1: 0
2: 1
3: 7
4: 190
1167188777_1167188780 10 Left 1167188777 19:47967831-47967853 CCTACTTCCATCTGTGTTGCTTG 0: 1
1: 0
2: 1
3: 25
4: 233
Right 1167188780 19:47967864-47967886 TTATATGTCAACCCATAGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 226
1167188777_1167188785 22 Left 1167188777 19:47967831-47967853 CCTACTTCCATCTGTGTTGCTTG 0: 1
1: 0
2: 1
3: 25
4: 233
Right 1167188785 19:47967876-47967898 CCATAGAAAGGATATTGAAGGGG 0: 1
1: 0
2: 0
3: 15
4: 189
1167188777_1167188781 20 Left 1167188777 19:47967831-47967853 CCTACTTCCATCTGTGTTGCTTG 0: 1
1: 0
2: 1
3: 25
4: 233
Right 1167188781 19:47967874-47967896 ACCCATAGAAAGGATATTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167188777 Original CRISPR CAAGCAACACAGATGGAAGT AGG (reversed) Intergenic
900544856 1:3222795-3222817 CAGGAATCACAGATGGATGTGGG - Intronic
901114006 1:6825993-6826015 CAAGGCACACAAATGGAACTTGG - Intronic
902720983 1:18303764-18303786 CTAGCAACACAGAGAGAGGTGGG + Intronic
907784942 1:57602552-57602574 CAAGCAACAGAAATGGATTTTGG + Intronic
908236490 1:62152103-62152125 CAAGCACCACACATGGTACTGGG + Intronic
908322371 1:62990964-62990986 AGAGAAACAGAGATGGAAGTAGG - Intergenic
908323896 1:63004791-63004813 CAAGCAACAGAAATGGATTTTGG + Intergenic
908623455 1:66012543-66012565 CAAACGGCACAGAAGGAAGTGGG - Intronic
909223058 1:72986367-72986389 CAAGGAACACATATTCAAGTTGG + Intergenic
909902397 1:81154248-81154270 CCAGCATCACAAATGGAGGTGGG - Intergenic
909976047 1:82047267-82047289 CAAGCTACACAGATGGGAAGTGG + Intergenic
910430406 1:87154402-87154424 CAGGCAAGACAGGTGGCAGTTGG + Intronic
911233370 1:95383704-95383726 TAAGAAAGACAGATGGATGTTGG - Intergenic
911715772 1:101131215-101131237 CAAGTTTCACATATGGAAGTGGG - Intergenic
912372577 1:109185382-109185404 CAAGCAAGAGAGAATGAAGTGGG - Intronic
914978703 1:152392606-152392628 AAAGCCACACAGATGGTAGGTGG + Intergenic
917084440 1:171291866-171291888 CAAGCAACAGCCATGGCAGTTGG - Intergenic
917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918871667 1:189982558-189982580 CAAGCAGCAATGATGGGAGTTGG + Intergenic
919739635 1:200974010-200974032 GAAGCAGCTCAGATCGAAGTGGG + Exonic
920606308 1:207391145-207391167 CAAGCAACAAAAATGTAAGCAGG - Intergenic
920760232 1:208776744-208776766 CAAGCACCACAGATGGCTGCAGG - Intergenic
920934847 1:210422548-210422570 GAGGCAACAAAGATGGAACTGGG - Intronic
920988252 1:210910999-210911021 CAATCTACACAAATGCAAGTAGG - Intronic
921095643 1:211885103-211885125 CAAGCAACACTCCTAGAAGTTGG - Intergenic
924188551 1:241522809-241522831 CAACCATCTCAGATGGAAGCAGG + Intergenic
924346999 1:243082047-243082069 CAAGAACCACAAATGGAAGAAGG + Intergenic
1063022164 10:2140209-2140231 CAAACAACACATAGAGAAGTTGG + Intergenic
1063260029 10:4377642-4377664 CATGCAAAACAGATAGAAATGGG + Intergenic
1064789461 10:18939566-18939588 GCAGCAAAACAGATGCAAGTGGG - Intergenic
1065250673 10:23808299-23808321 GAAGTAACACAGAGGGAATTAGG + Intronic
1065511335 10:26481174-26481196 CCAGACAGACAGATGGAAGTGGG + Intronic
1065563325 10:26985041-26985063 CAAGCAACAGCGATGGCAGTTGG - Intergenic
1066237530 10:33500994-33501016 CAAGGAACAAAGATGAAAGTGGG + Intergenic
1068514422 10:58008453-58008475 ACAGCAACACAGAGGGAAGAAGG + Intergenic
1068803957 10:61173723-61173745 CAAGCAAGACAAGAGGAAGTGGG - Intergenic
1069874737 10:71554884-71554906 ATAGCAACAGAGAAGGAAGTGGG + Intronic
1070346099 10:75543453-75543475 CAAGAAAAAAAAATGGAAGTGGG + Intronic
1071116891 10:82232450-82232472 CAAGCAACACAGAGGGAGTGGGG - Intronic
1072289269 10:93947679-93947701 CTAGAAACACAGTGGGAAGTAGG + Intronic
1072296150 10:94011239-94011261 CAAGCAAGACAGAGAGAAGGGGG + Intronic
1073597441 10:104815064-104815086 CAAACAGCACTGATGGAAGGAGG + Intronic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1077988525 11:7380137-7380159 GCAACAACACAGATGGAACTGGG + Intronic
1080503325 11:32890144-32890166 CAATAAACTCAGAAGGAAGTGGG - Intergenic
1083531404 11:63426502-63426524 CCAGCAACATGGATGGAAATGGG - Intergenic
1083550175 11:63582359-63582381 CAACCAGCACAGAGGGAAGAAGG + Intronic
1084064670 11:66696936-66696958 CAAGCAGAAAAGCTGGAAGTGGG - Intronic
1084466895 11:69328546-69328568 CAAGCAGCAGAGATGGGGGTAGG - Intronic
1085424279 11:76389843-76389865 CAAGCAACACAGATGTACACGGG + Intronic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1086334415 11:85785322-85785344 CAAGCAACACAGCTGGACCCAGG + Intronic
1087654725 11:100908535-100908557 ACAGCAACATAGATGGAACTGGG - Intronic
1088193388 11:107250635-107250657 CAAGAAAGCCAGTTGGAAGTGGG - Intergenic
1088344669 11:108809359-108809381 CAACCAACACACATGGAGGAAGG - Intronic
1090540496 11:127698115-127698137 CAAGCAATGCTGATGGAAGCAGG - Intergenic
1090712463 11:129399944-129399966 CAGACACCACAGGTGGAAGTTGG - Intronic
1091621627 12:2093474-2093496 TGAGCTGCACAGATGGAAGTGGG + Intronic
1091648894 12:2294823-2294845 CAAGCAAGAGAGTTGGCAGTAGG + Intronic
1093705881 12:22274720-22274742 CAGGCAACAGCGATGGAAGAAGG - Intronic
1094304470 12:29002051-29002073 AAAGAAACACAGATGGAACTAGG + Intergenic
1097851594 12:64416100-64416122 CTAGAAAGACAGTTGGAAGTGGG + Intronic
1098387689 12:69935991-69936013 CAGGCCACACAGATGGGAGCAGG - Intronic
1098713843 12:73802983-73803005 GTAACAACACAGATGGAACTTGG - Intergenic
1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG + Intergenic
1100475341 12:94930394-94930416 CAAACAAAACAGTTGGAAGGTGG - Intronic
1101266187 12:103090379-103090401 GAAGAAACACAGATTGAAATGGG + Intergenic
1101742287 12:107510077-107510099 CTAGCCACACAGCTGGAAGCCGG + Intronic
1102066828 12:109984047-109984069 CAGGCCACACAGCTTGAAGTGGG - Intronic
1102579453 12:113877027-113877049 CAAGCCACAGAGATGGCACTTGG + Intronic
1107036351 13:35906530-35906552 CAGGCAACAGAGATGAAAGGAGG + Intronic
1108119919 13:47173894-47173916 CAAGCAACACATCAGGAAGTTGG - Intergenic
1113045509 13:106150696-106150718 CAAGCAAAACAGCTTGCAGTTGG + Intergenic
1117094566 14:52284014-52284036 CAAGCAACAGCGATGGCAGTTGG + Intergenic
1117331810 14:54719861-54719883 TAACTAACACAGATGGGAGTAGG - Intronic
1120010919 14:79413348-79413370 CAAACAGCACAGATGGAAGGAGG - Intronic
1121478716 14:94240520-94240542 AAAGCAACAACGATGGAGGTGGG - Intronic
1122841500 14:104466385-104466407 TAAGGAACACAGATGGATCTTGG - Intergenic
1124020668 15:25919733-25919755 CAAGCAACACAAGTGAAAATAGG - Intergenic
1125082117 15:35687084-35687106 AAAGCAACAGGGGTGGAAGTAGG - Intergenic
1125443737 15:39731002-39731024 CAAGTAACAAAGATGGACTTTGG - Intronic
1125750946 15:42027891-42027913 AGAGCAACACAGAAGCAAGTAGG - Intronic
1127892313 15:63264859-63264881 GAACCAAAACAGATGGAACTGGG - Exonic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129525594 15:76211896-76211918 CAAGGAACACCGATGGAATTAGG - Intronic
1129939285 15:79479695-79479717 TAAGCAACACAGCTGGGACTTGG + Intergenic
1135898095 16:26428853-26428875 GCAGCAACATAGATGGAACTGGG + Intergenic
1136144785 16:28310134-28310156 TCAGCAACACAGATGGCAGATGG + Intronic
1139445490 16:66995678-66995700 CAAGGAAAACAGATGCATGTGGG + Exonic
1140582243 16:76245203-76245225 AAAGAAAAACAGAAGGAAGTGGG + Intergenic
1140825040 16:78698200-78698222 CAGACAACACAGATGGAGTTTGG + Intronic
1141956617 16:87376215-87376237 CAAGCAACAAAAATGGGAGTGGG - Intronic
1142245117 16:88966797-88966819 AGAGCCACCCAGATGGAAGTCGG + Intronic
1142899188 17:3001921-3001943 CTAGCACCACAGCTGGAGGTGGG - Intronic
1143906043 17:10210039-10210061 CAAGCAAAACAGTTGGGACTCGG - Intergenic
1144099332 17:11930167-11930189 CATGCAACTCAGAAGGGAGTCGG + Intronic
1146479901 17:33196852-33196874 CATGACACACAGATGGGAGTAGG + Intronic
1146593810 17:34152601-34152623 CCAGCTACAAAGATGGAAGGTGG - Intronic
1148085738 17:44992831-44992853 AAAGCAGCACACATGGAAGGTGG + Intergenic
1148794904 17:50192316-50192338 GGAGCAGCACAGAGGGAAGTGGG - Intronic
1148973468 17:51505539-51505561 CCAGGAAAACAGCTGGAAGTGGG - Intergenic
1149100240 17:52897330-52897352 CACGTAACACAGATGAAAGTAGG - Intronic
1149264201 17:54909755-54909777 CAAGGAACAAAGACTGAAGTGGG - Intronic
1149356947 17:55848773-55848795 ACAGCAACAGAGCTGGAAGTTGG + Intergenic
1150535236 17:66031956-66031978 AAAGCAACACACAGAGAAGTGGG + Intronic
1157809369 18:50683795-50683817 CTGGCAACACAGCTGGATGTAGG + Intronic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1159557823 18:69963302-69963324 CAAGGAACACATATTCAAGTTGG - Intergenic
1159791876 18:72791993-72792015 CAAGCATCAAAGCTGGAAGCTGG + Intronic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1166360855 19:42252493-42252515 CATGCAACACAAAGGGAACTCGG + Intronic
1166958091 19:46479364-46479386 CAAGCAACATAGATGTCTGTAGG - Intergenic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
925003111 2:421840-421862 CAAGCACTACAGATTGAAGCTGG + Intergenic
925148032 2:1594034-1594056 AAAGGAACAGAGATGGGAGTGGG - Intergenic
925884422 2:8382221-8382243 CAAGCATCAGGGATGGAAGATGG + Intergenic
927141106 2:20131321-20131343 CAAGCCACACGGAGGGAAGCTGG + Intergenic
930363831 2:50413875-50413897 GCAACAACACAGATGGAACTGGG + Intronic
931086328 2:58834768-58834790 GAAGGAGCACAGAAGGAAGTGGG - Intergenic
932520007 2:72401712-72401734 CCAGCAACATGGATGGAACTAGG + Intronic
934065814 2:88340638-88340660 CAACAAACACAGATGATAGTTGG + Intergenic
934984164 2:98872016-98872038 CCAGCAACACAGATGGAGCTGGG + Intronic
936344626 2:111665892-111665914 CTAGCATCACAGAAGGAAGGTGG - Intergenic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936485249 2:112919848-112919870 CAAGCAGCGAAGATGGGAGTGGG - Intergenic
936881942 2:117263918-117263940 CTTGCAAGACAGAAGGAAGTGGG - Intergenic
939173283 2:138720916-138720938 AATGCAAAACAGATGGAAATAGG + Intronic
939431465 2:142114612-142114634 ACAGCAACATAGATGGAACTGGG + Intronic
941091021 2:161175773-161175795 CAAGCAAAACTGAGGGCAGTCGG - Intronic
944971678 2:205000778-205000800 CAAGCAATATGGATGGAAGTAGG - Intronic
946547093 2:220756144-220756166 CCAGCGACACAGATTCAAGTTGG - Intergenic
946650573 2:221889140-221889162 CAAGAAACAAAGATGGGAGTGGG - Intergenic
947318979 2:228896009-228896031 AAGGCAACACAGAGGGGAGTAGG - Intronic
947883244 2:233540174-233540196 CAAGCAACACTGATGAAAAAAGG + Intronic
949005067 2:241641249-241641271 TAAGCAACTCAGATGGAGGGGGG + Intronic
1169995767 20:11554538-11554560 CAAGCAAAACACATGAAAGCTGG - Intergenic
1170018923 20:11814013-11814035 CAAGCAGCCCTGATGGGAGTTGG + Intergenic
1174166163 20:48584929-48584951 CCAGAAACACAGATCCAAGTGGG + Intergenic
1174979287 20:55375014-55375036 CAACCAACAGAGATTGCAGTGGG - Intergenic
1175342994 20:58246694-58246716 CAATGAACTCTGATGGAAGTGGG + Intergenic
1175558601 20:59896114-59896136 CAAAGTACACAGCTGGAAGTGGG + Intronic
1175962494 20:62644185-62644207 CCAGCAGCACAGAGGGAAGTCGG - Intronic
1177374128 21:20246531-20246553 GAAGCAACACATATGGAAGGTGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1179953707 21:44726312-44726334 TCAGCAACATAGATGGAACTGGG + Intergenic
1180624659 22:17186188-17186210 AAAGCCACACAGCTGGAAATTGG - Intronic
1181987542 22:26810958-26810980 CAAGGACCACAGAGGGCAGTGGG - Intergenic
1182086715 22:27565921-27565943 CAAGTCACACAGATGTTAGTGGG - Intergenic
1183407081 22:37635489-37635511 AAATCAACAGAAATGGAAGTGGG - Intronic
949136345 3:571137-571159 GAAGCAAGACAGATAGGAGTTGG - Intergenic
950912894 3:16613689-16613711 CAAGCAACTCAAAGGGAAATTGG - Intronic
951992777 3:28694311-28694333 AAAGCAACTGAGATGGCAGTGGG + Intergenic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
953210009 3:40867438-40867460 CCAGAAACACACATGGATGTTGG - Intergenic
953363973 3:42325936-42325958 AAAGCAAGACAGTGGGAAGTTGG - Intergenic
953521552 3:43648027-43648049 CAAGTAACCTAGATGGAGGTTGG - Intronic
953799493 3:46011438-46011460 CAAGCCACACTGATGGAAGGAGG + Intergenic
955621691 3:60871079-60871101 CAAGAACCACAGATGGAAACGGG - Intronic
956253847 3:67263215-67263237 CCAGCAGCACAGAGGGAAGGGGG + Intergenic
960853307 3:122077957-122077979 CAAGGAACACAGAAGCAAGGTGG - Intronic
961917519 3:130392697-130392719 CAAGTTACAGATATGGAAGTGGG - Intronic
963380113 3:144518723-144518745 CAAGCTACACAGATGATAGAAGG + Intergenic
964988252 3:162771960-162771982 CAAGCAACAGTGATGGCAGTTGG + Intergenic
966046512 3:175557699-175557721 CAAACAACATTGATGGAACTGGG - Intronic
967525370 3:190486659-190486681 CTAGCAGCACAGATGGCACTGGG + Intergenic
967916965 3:194585928-194585950 CAAGCCACACAGATGATAGGCGG + Intergenic
970121289 4:12755598-12755620 AATGCAACACTGCTGGAAGTTGG + Intergenic
973056206 4:45661853-45661875 CAAGAAGCACAGAAGCAAGTAGG - Intergenic
975813824 4:78196811-78196833 CAAGCCCCACAAATTGAAGTTGG - Intronic
976419968 4:84830698-84830720 CATGCAGCATAGATGGAATTAGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979587246 4:122435359-122435381 CAAGAAACACAGATTTAAATTGG - Intergenic
979801742 4:124918096-124918118 CAAACAAAACAGATAGAAATTGG - Intergenic
980767952 4:137332536-137332558 CAAGAGAGACAGAGGGAAGTTGG + Intergenic
981514146 4:145588577-145588599 CAAGCAATTCTGATGGAATTGGG + Intergenic
982972354 4:162005190-162005212 CAGGAAACAGAGCTGGAAGTTGG - Intronic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
984750387 4:183267182-183267204 CAAGCATCAAAGCTGGAGGTAGG + Intronic
985841731 5:2311039-2311061 CAAGCAACACAGAGAAATGTTGG - Intergenic
986345939 5:6835234-6835256 CAAGCATGACACAAGGAAGTTGG + Intergenic
987257672 5:16173188-16173210 CAAGCAACAAAGGAGGAAGAAGG + Intronic
987265423 5:16248513-16248535 TATGCAATACAGATGGAAGGGGG - Intergenic
987319876 5:16758676-16758698 CAAGCAACACAGCTGGGAAGTGG - Intronic
988156362 5:27455932-27455954 AAAGCAACACTGAAGGAAATAGG + Intergenic
990546807 5:56830357-56830379 CAAGAAACAGAGACGGAACTTGG - Intronic
990561875 5:56991653-56991675 TTAGAAACACAGATTGAAGTAGG - Intergenic
990593908 5:57294179-57294201 CAAGCTACAGAGATGGGAGTAGG + Intergenic
990666229 5:58075513-58075535 CAAGCACCAAAGTTTGAAGTTGG + Intergenic
990975155 5:61553594-61553616 GCAGCAACACAGCTGGAACTGGG - Intergenic
991179247 5:63729745-63729767 TAGGAAACATAGATGGAAGTAGG + Intergenic
993671192 5:90763821-90763843 GAAGCAACATAGATGCAATTAGG - Intronic
995097023 5:108248766-108248788 CATGTAAGCCAGATGGAAGTAGG + Intronic
996486817 5:124044874-124044896 CATGCAGCATACATGGAAGTGGG + Intergenic
997193800 5:131963944-131963966 AAAGCCACACAGCTAGAAGTTGG + Intronic
997544387 5:134693523-134693545 CAAGCAAGACAAATCAAAGTTGG - Intronic
997853993 5:137357000-137357022 CCAGGAACACAAAGGGAAGTTGG + Intronic
998584371 5:143411418-143411440 GAAGCAACAAAAATGGATGTTGG - Intronic
998739623 5:145185672-145185694 AAAACAATACAGATGTAAGTTGG + Intergenic
998899899 5:146842176-146842198 CAAGCACTTCAGATGGAAGAAGG - Intronic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1007154425 6:39728635-39728657 CAAGCAAAATAGATGGGAGTGGG + Intergenic
1009598471 6:65767048-65767070 TAAGCAACTCAGATGGAAAAAGG - Intergenic
1011176685 6:84569307-84569329 CAAGGAACCCAGAAGGAATTTGG + Intergenic
1012739091 6:102991301-102991323 TAAACAACATAGATGGAACTGGG + Intergenic
1012984228 6:105857836-105857858 AAAGGAAAACAGATGGAAATAGG - Intergenic
1013496197 6:110699944-110699966 CAAGCCACACAGCAGGAGGTGGG + Intronic
1014035719 6:116765264-116765286 AAAGCAACCCAGATGGACGCGGG + Intronic
1014057571 6:117034054-117034076 CAAGAAACAAGGATAGAAGTAGG + Intergenic
1014241257 6:119020455-119020477 CAAGCTAAACAGGTTGAAGTAGG + Intronic
1015552168 6:134423056-134423078 TAGGGAACTCAGATGGAAGTGGG + Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1017280605 6:152620269-152620291 CACTCAACACTGAGGGAAGTGGG - Intronic
1020034689 7:4957977-4957999 CAAGCCACACTGATGTGAGTAGG + Intronic
1021426322 7:20503539-20503561 CTAGAAAGACAGATGAAAGTTGG + Intergenic
1021840445 7:24717833-24717855 CCAGGAACAGAGAGGGAAGTGGG + Intronic
1022805474 7:33816984-33817006 CAAGTCACACAGATGGAAGGTGG + Intergenic
1023377797 7:39576150-39576172 AAAGCAACTCAGTTAGAAGTAGG - Intronic
1024427184 7:49239859-49239881 GAGGCAACACAGCTGGAAGTTGG + Intergenic
1026259705 7:68744447-68744469 CAAGCAACACAGAACGATGACGG - Intergenic
1026534754 7:71230416-71230438 CAAGAAACAGGGAGGGAAGTTGG + Intronic
1030643797 7:112036431-112036453 CAAGCAACATAAAGGGAGGTGGG + Intronic
1034021774 7:147652155-147652177 CTAGTAACACTGATGGAAGTTGG + Intronic
1035645302 8:1214248-1214270 CAACCAACCCAGGTGGAACTGGG + Intergenic
1037071222 8:14651979-14652001 CAGGAAACACAGCTGGTAGTAGG - Intronic
1040621343 8:49096198-49096220 CAAGCAACCCCCATGCAAGTGGG + Intergenic
1041207889 8:55516972-55516994 GCAGCAACATAGATGGAACTGGG + Intronic
1041866853 8:62583601-62583623 CAAGGAACACAGGTGGTAGTGGG + Intronic
1044895994 8:96891785-96891807 CAAGCAACAGTGATAGAAGGTGG + Intronic
1048705921 8:137153932-137153954 GCAACAACACAGATGGAACTGGG - Intergenic
1048826244 8:138430221-138430243 TTATCAATACAGATGGAAGTGGG - Intronic
1050684671 9:8154277-8154299 CAAGCAAAGAAAATGGAAGTAGG + Intergenic
1052178512 9:25495662-25495684 CAAGAAAAAGAGATTGAAGTTGG - Intergenic
1055805527 9:80088869-80088891 CAGGCCACAGAGATGGAAGCGGG + Intergenic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1056993787 9:91435943-91435965 CAAGCAACACAGACCGATTTTGG + Intergenic
1058588524 9:106535794-106535816 CATCCAACACAGATGAAGGTAGG + Intergenic
1059388690 9:113985251-113985273 CAAGCACCAGACTTGGAAGTTGG - Intronic
1061225810 9:129280493-129280515 CCACAAACACAGATGGAAATCGG - Intergenic
1186750582 X:12617831-12617853 CAAGAAACACAAATGGATCTGGG - Intronic
1187653649 X:21442846-21442868 GCAGCAACACAGATGGAGCTTGG + Intronic
1188995145 X:36875429-36875451 GCAGCAACATAGATGGAATTGGG + Intergenic
1189159489 X:38796854-38796876 CAAGCAACAAAACTGGAAGATGG - Intergenic
1189277042 X:39794295-39794317 GAAGGCACACAGATGGAGGTGGG + Intergenic
1190119037 X:47645403-47645425 CAAGTCACACAGCTGGAAGTTGG + Intronic
1192926239 X:75758237-75758259 CAAACAGCAAAGATGGAGGTTGG - Intergenic
1193143468 X:78054061-78054083 CAGGCAACACTGATGCAAGTGGG + Intergenic
1193294824 X:79821881-79821903 CAAGCAACAGCTATGGCAGTTGG - Intergenic
1194865393 X:99058723-99058745 CAAGCAACACACATTCTAGTAGG - Intergenic
1195904581 X:109830789-109830811 AAAGAACCACAGAAGGAAGTGGG + Intergenic
1198281591 X:135148209-135148231 GAAGAGACACAGATGGAAATAGG + Intergenic
1198289368 X:135224313-135224335 GAAGAGACACAGATGGAAATAGG - Intergenic
1199299121 X:146192638-146192660 CAAACATCAAAAATGGAAGTAGG - Intergenic
1199651711 X:149951502-149951524 AAAGCAGGACAAATGGAAGTTGG + Intergenic
1200031486 X:153300013-153300035 CAAGCAAGACAGAGAGAAGGAGG - Intergenic
1201549023 Y:15199469-15199491 GCAGCAAGACAGATGGAACTGGG + Intergenic