ID: 1167191288

View in Genome Browser
Species Human (GRCh38)
Location 19:47991750-47991772
Sequence GTGAAGAAGGAAGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4662
Summary {0: 1, 1: 1, 2: 55, 3: 666, 4: 3939}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167191288 Original CRISPR GTGAAGAAGGAAGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr