ID: 1167192976

View in Genome Browser
Species Human (GRCh38)
Location 19:48004589-48004611
Sequence CTGGAGGAACAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 954
Summary {0: 1, 1: 0, 2: 8, 3: 97, 4: 848}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167192976 Original CRISPR CTGGAGGAACAGATGGAGGA GGG (reversed) Intronic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900889900 1:5442073-5442095 CTGGAAGACCTGATGGAGGGAGG + Intergenic
900919172 1:5659831-5659853 CTGGAGGATCCGATGGCAGATGG - Intergenic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
901821554 1:11833612-11833634 CTGGTGGAAGAGCTGGAGGATGG - Exonic
901874796 1:12161376-12161398 CTGCAGGAAAGGATGCAGGATGG - Intergenic
902438856 1:16416132-16416154 CTTGTGGCACAGATGGATGAAGG - Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
902724650 1:18326718-18326740 AGGGAGGGACAGATGGAGGGAGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903567202 1:24276893-24276915 CGGGAGGAACAGAGCGAGCATGG + Intergenic
904314771 1:29653123-29653145 CAGGTGGAAAAGGTGGAGGAGGG - Intergenic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
905886455 1:41494545-41494567 TTGGAGGACCAGATGAATGAAGG - Intergenic
906152929 1:43598449-43598471 ATGGGGGAACAGGTGGAGGTGGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906320151 1:44810590-44810612 CTGGAGGAACTGAGAGAGGTGGG + Exonic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
907220697 1:52905118-52905140 CTGGGGGACCGGATGGGGGAGGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908618466 1:65949331-65949353 CTGTAGCAAATGATGGAGGAAGG - Intronic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911527560 1:99004813-99004835 CTGGAGGAAGAGGCGGAGGCAGG + Exonic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
911904806 1:103553383-103553405 CTGGATCAACAGGTGGGGGAAGG - Exonic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
912953312 1:114135472-114135494 TAGGAGGAGGAGATGGAGGAGGG + Intronic
913475641 1:119234692-119234714 CTGCAGGAAGAAATGAAGGAAGG - Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915064002 1:153209889-153209911 CTGGAGTAAGAACTGGAGGAAGG - Intergenic
915865949 1:159499568-159499590 TAGGAAGAACAGATGGAGAAAGG - Intergenic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
916406330 1:164501023-164501045 CTGGAGGAACAGGTGGCTGTGGG + Intergenic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916713999 1:167434920-167434942 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714007 1:167434945-167434967 CCGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714021 1:167434982-167435004 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714034 1:167435019-167435041 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714047 1:167435056-167435078 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714073 1:167435130-167435152 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714086 1:167435167-167435189 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714099 1:167435204-167435226 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714112 1:167435241-167435263 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714144 1:167435340-167435362 TTGGAGGAAGGGCTGGAGGAGGG - Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
918185859 1:182127231-182127253 CTGGAGGAACAGGGCTAGGAAGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
920955673 1:210618566-210618588 CTGGAGGAGCAGATGGCCGGAGG - Intronic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923238413 1:232057414-232057436 TCGGAGGAACATATGGTGGAGGG - Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923859838 1:237882538-237882560 CTACAGGAACACCTGGAGGATGG + Exonic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924350465 1:243109420-243109442 CTAGAGTAAGAGATGGACGAAGG - Intergenic
924632311 1:245752548-245752570 CTGGAAGAAAAGAGCGAGGAAGG - Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1064121424 10:12623080-12623102 ATGGAGGAAGGGAGGGAGGAAGG - Intronic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1065645621 10:27831048-27831070 CTGGAGGAGTGGATGGGGGAGGG + Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1066491768 10:35901105-35901127 GTGGAGGAACCCATGGATGATGG + Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067292851 10:44957048-44957070 CTGGACGCAGAGATGGGGGAAGG - Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1068813504 10:61283326-61283348 CGGGAGGAAGTGATGGTGGAGGG + Intergenic
1069619535 10:69828273-69828295 CAGGAGGAAGAGATGGGGGTGGG - Intronic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070605470 10:77895201-77895223 GTGGAGGAAGAGATGTATGATGG - Intronic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1071693254 10:87844586-87844608 GTGGAGGAACAGGTGGAGAGTGG - Intergenic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073136439 10:101223038-101223060 CTGGGGGAACAGATGGGCAAAGG + Intergenic
1073977948 10:109121678-109121700 ATGGAGGAAGGGAGGGAGGAAGG - Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074188863 10:111118475-111118497 AGAGAGGAACAGATGTAGGAAGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076292756 10:129360378-129360400 CTGGAGGAACAGACGGATTTAGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077222094 11:1422310-1422332 GTGGAGGAGCGGCTGGAGGAGGG - Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077392572 11:2306913-2306935 AGGGAGGAGGAGATGGAGGAGGG + Intronic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078118431 11:8480245-8480267 CTGGAGCATCAGGTGGAAGAAGG + Intronic
1078178124 11:8985982-8986004 CTGGAACAACATATGTAGGATGG - Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080127527 11:28754454-28754476 AGGGAGGAACAGAGGGAAGAAGG + Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1081992436 11:47345164-47345186 AAGGAGGAAAAGATGGAGGCTGG - Intronic
1083457731 11:62790183-62790205 CTGCAGGAAGAGGTGGAGGGGGG - Exonic
1083687038 11:64382682-64382704 ATGGAGGACCGTATGGAGGAGGG - Intergenic
1083735966 11:64681467-64681489 CTGGAGGAAGGGATCAAGGAAGG + Intronic
1083832508 11:65241802-65241824 CTGGAGGAACAATAGGAGGGTGG + Intergenic
1084082807 11:66840052-66840074 CTGGTGGAACCCCTGGAGGATGG + Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084667819 11:70585921-70585943 ATGGAGGAATGGATGAAGGATGG - Intronic
1084672322 11:70614667-70614689 CTGGAGGATGGGATGAAGGAAGG - Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1085115523 11:73928232-73928254 CTAGAGGAAGAGATGGTGGAGGG + Intergenic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087182602 11:95154646-95154668 CTGCAGGAGCATTTGGAGGAGGG - Intergenic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1087474858 11:98622232-98622254 TGGGAGGAAGAGAGGGAGGAGGG - Intergenic
1087518821 11:99203036-99203058 AGGGAGGAAGAGAGGGAGGAAGG + Intronic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089958759 11:122597249-122597271 ATGGAGGGAGGGATGGAGGAAGG + Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090387583 11:126365711-126365733 CTGGTGGGGCAGCTGGAGGAAGG + Intronic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090860868 11:130651309-130651331 CTGGAGGATCAGCTGGGGGCTGG - Intergenic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091779269 12:3203821-3203843 GTGGAGGAGCAGGTGCAGGAGGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093472911 12:19524025-19524047 AGGGAGGGAGAGATGGAGGAAGG - Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094136778 12:27136106-27136128 ATGAAGGAAGAGGTGGAGGATGG + Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1094711248 12:32964861-32964883 CTTTAGGAAAACATGGAGGAGGG - Intergenic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1096068306 12:48758795-48758817 TTGGAGGAAAAGAAGGAGGTAGG - Intergenic
1096101248 12:48971628-48971650 CGGGAGGAAGGGAGGGAGGAAGG + Exonic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096591660 12:52664026-52664048 CTGGAGGAATACAGGAAGGAGGG - Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1097029267 12:56079942-56079964 TTGGCGGAGCAGATCGAGGATGG - Exonic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1097357743 12:58621041-58621063 CTAGAGGAACAGAGGCTGGAAGG - Intronic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099441645 12:82706418-82706440 CTGGAGGATAGGATGGAGGGAGG + Intronic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100449322 12:94690251-94690273 CTGGAGTAATAGATGGAGGCTGG - Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102526569 12:113516239-113516261 ATGGAGGAAGGGATGGAGGGAGG - Intergenic
1102526574 12:113516251-113516273 ATGGAGGAAGGGATGGAGGAAGG - Intergenic
1102526578 12:113516263-113516285 AGGGAGGAAGGGATGGAGGAAGG - Intergenic
1102547644 12:113668123-113668145 CTGGAGGAGGAGGTGAAGGAGGG - Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1103617299 12:122162449-122162471 CTGGAGGACAGGATGAAGGAAGG - Intergenic
1103905447 12:124325258-124325280 CTGGACGGACAGATGGATGGAGG + Exonic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104668804 12:130666808-130666830 AGGGAGGAAGAGATGGAAGAAGG + Intronic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104779297 12:131409610-131409632 ATGGAGGAATAGATGAATGATGG - Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105821986 13:24087966-24087988 CTGGAGGAGATGCTGGAGGAAGG - Intronic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107630020 13:42333728-42333750 ATGAGGGAAGAGATGGAGGAGGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110546598 13:76763021-76763043 CTGGATGAACCGGTGGAGGTTGG - Intergenic
1110810934 13:79809875-79809897 CTGAAGGATGAGATGAAGGAAGG - Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113060070 13:106313580-106313602 CTGGAAGAACCAATGCAGGATGG + Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1113900204 13:113792628-113792650 CTGGAGGAACAGACAGATGAGGG - Intronic
1113962351 13:114132836-114132858 CTGGCGGAAGAGACGAAGGAAGG + Intergenic
1114695942 14:24627853-24627875 CTGGAGGAAAAGAGGGATGGTGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1117531027 14:56661012-56661034 CTGAAGGAAAAGCTGGAGGCGGG + Intronic
1117690111 14:58298001-58298023 CTGGAGGAAACGGTGGAGGACGG + Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1119499527 14:75112357-75112379 CTAGAGGAACAGAGGGATAAAGG + Intronic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119944340 14:78676038-78676060 CTGGAGGAACAGCTGGTTGGTGG - Intronic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1121223281 14:92302413-92302435 CTGGAGGCTGAGGTGGAGGATGG + Intergenic
1121308819 14:92923832-92923854 GCGGGGGAAGAGATGGAGGAAGG - Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121447545 14:93988268-93988290 TGGGAGGAAAGGATGGAGGAGGG + Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122631236 14:103108712-103108734 CTGGTGGGGCTGATGGAGGATGG - Intronic
1122646007 14:103194666-103194688 CTTGTGGAGTAGATGGAGGAAGG + Intergenic
1122880170 14:104687269-104687291 CTGGAGGTACAGAGGGTTGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125823675 15:42656973-42656995 TTGGAGGAACAGATGGTGTCTGG - Intronic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126982790 15:54264774-54264796 CTCGAGGACCAAATGGATGAGGG - Intronic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127117016 15:55738874-55738896 CAGGAGGAAAAGACAGAGGAAGG + Intronic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128680841 15:69650240-69650262 CTGGAGGATCTGCTGGAGGTTGG - Intergenic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1129899563 15:79136071-79136093 TTGGAGGAACGGAGGGAGGGAGG - Intergenic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131248715 15:90817420-90817442 CTGGAAGATGAGCTGGAGGAAGG - Intergenic
1131427725 15:92360546-92360568 CTGGAGGAGCAAATGGGGGAAGG + Intergenic
1131460040 15:92611279-92611301 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
1131833211 15:96367264-96367286 CCGGAGGGAGAGCTGGAGGAAGG - Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131869170 15:96743894-96743916 CTTGTGGAAGGGATGGAGGAAGG + Intergenic
1132113545 15:99119466-99119488 CTGGAAGACAAGATGAAGGATGG + Intronic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132338349 15:101063095-101063117 CGGGAGGCAGAGATGGAGGGAGG - Intronic
1132483441 16:177642-177664 CGGGAGGAGGGGATGGAGGAGGG + Intergenic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134287995 16:12879180-12879202 AGAGAGGAAGAGATGGAGGAAGG - Intergenic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134810911 16:17166346-17166368 CTGGAGGAACAGATGGGAATTGG - Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135693704 16:24567350-24567372 CTGGAGGAAACCCTGGAGGAGGG - Exonic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1136074847 16:27809930-27809952 CTGGAGGAGAAGATGGGGGAAGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1136617356 16:31406632-31406654 TTGGAGGCACCCATGGAGGAAGG - Intronic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137495049 16:48963052-48963074 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1142846556 17:2681819-2681841 CCAGAGGAAAAGAGGGAGGAGGG - Exonic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143766312 17:9139821-9139843 ATGGATGAACAGATGATGGAAGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1144958986 17:19034307-19034329 CGGGAGGAAGGGATGAAGGAAGG - Intronic
1144976173 17:19140217-19140239 CGGGAGGAAGGGATGAAGGAAGG + Intronic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146787976 17:35734861-35734883 ATGCAGGAAAAAATGGAGGAGGG + Intronic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148105932 17:45118871-45118893 CTGGAGGACCAGGGCGAGGAGGG - Exonic
1148552150 17:48556865-48556887 CTGGCAGAAGAGATGGAAGATGG + Intronic
1148757956 17:49984433-49984455 CTGGAGGATTAGCTGGAGCAGGG - Intergenic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156337368 18:36183628-36183650 CTGGAGGAGGAGGTGGGGGAAGG - Intergenic
1156381660 18:36567288-36567310 AGGGAGGAAGAGATGGAGGAAGG + Intronic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1156967582 18:43114015-43114037 AAGGAGGAAGGGATGGAGGAAGG - Intronic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1157977488 18:52342362-52342384 CGGGAGGGACAGACGGAGGGAGG - Intronic
1158689834 18:59650375-59650397 ATGGAGGAACCTAGGGAGGAAGG - Intronic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160502519 18:79409294-79409316 ATGGAGGAATGGATGGATGATGG - Intronic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160973930 19:1783251-1783273 CAGGAGGAGAAGGTGGAGGAGGG - Exonic
1161157281 19:2739218-2739240 CTGGCTGAACACATGGACGAGGG + Intronic
1161329013 19:3677745-3677767 ATGGAGGGAGGGATGGAGGATGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162085923 19:8249094-8249116 ATGGGCGAACAGATGGATGATGG + Intronic
1162138505 19:8571037-8571059 CAGGAGGAAGGGCTGGAGGAGGG + Intronic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162823704 19:13238137-13238159 ATGCAGGAAGAGATGGAGGGTGG - Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163273289 19:16266971-16266993 CTGGAGGAAGGGATGCTGGAAGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1164800670 19:31073626-31073648 AGGGAGGAAGAGATGAAGGAAGG - Intergenic
1165136790 19:33674662-33674684 CGGGAGGCACAGATGGCAGATGG + Intronic
1165277471 19:34767418-34767440 ATGGAGAAACAAATGGAGTATGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165580009 19:36854286-36854308 GAGGAGGAAGAGGTGGAGGAGGG - Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1166146309 19:40838741-40838763 AAGGAGGAAGAGATGGAGAAAGG - Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167233916 19:48302493-48302515 TTGGAGGGACAGATGATGGATGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167601370 19:50456858-50456880 ATGGAGGTACAGATGATGGATGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167633052 19:50637757-50637779 AAGGAGGAAGAGATGGAGAAGGG + Exonic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925299435 2:2800149-2800171 AAGGAGGAAGGGATGGAGGAAGG + Intergenic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927798404 2:26073244-26073266 CTAGAGGAACAAATGGGAGAAGG + Intronic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930569460 2:53066553-53066575 CTGGATGAATAGATGATGGATGG + Intergenic
931166394 2:59753859-59753881 CGTGAGGAATACATGGAGGATGG + Intergenic
931804205 2:65788782-65788804 CCTGAGTAACAGATGGAGGCAGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933747081 2:85579192-85579214 CTGGAGGAAAACAGGGAGGGAGG + Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
933982660 2:87565784-87565806 CCAGAGGAAAAGAGGGAGGAAGG + Intergenic
934628862 2:95892927-95892949 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629269 2:95898536-95898558 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629684 2:95904152-95904174 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934630095 2:95909764-95909786 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934720249 2:96569541-96569563 CTGAATGAACTGATGGGGGATGG + Intergenic
934803825 2:97197375-97197397 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934804243 2:97202980-97203002 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934832816 2:97548798-97548820 CTGCAGGAACTGCTGGAAGAAGG - Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935865825 2:107386679-107386701 CTGAAGGAACAGCTGGATGCTGG - Intergenic
936311180 2:111385009-111385031 CCAGAGGAAAAGAGGGAGGAAGG - Intergenic
937487059 2:122326272-122326294 CTGGAGGAAAAGAAAGGGGAAGG + Intergenic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938029817 2:127982397-127982419 CTAGAGGAACAGACAGAGGCAGG + Intronic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
939475532 2:142681535-142681557 CTAGAGGCACAGAGGGACGAAGG + Intergenic
940010147 2:149044585-149044607 TTGGAGGAAGAGAAGGAGGGAGG - Intronic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
940806641 2:158194879-158194901 GTGGATGAGCAGATGGGGGATGG - Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
940875458 2:158893245-158893267 GTGGAGGAACAGATGGCTGCAGG + Intergenic
941152870 2:161937379-161937401 GTGGAGGAAGAGATGGGGTATGG - Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
942134838 2:172914548-172914570 ATGGAGGAAGAGAGGGAGGGAGG + Intronic
942200611 2:173567379-173567401 CAGGAGGAAAACATGGTGGAGGG + Intergenic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
942980137 2:182070878-182070900 TAGGAGGAAGAGAGGGAGGAGGG + Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943808209 2:192150728-192150750 CTCAGGGAACAAATGGAGGATGG + Intronic
945484208 2:210375681-210375703 GTGAAGGAAGAGCTGGAGGAAGG + Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946552849 2:220822564-220822586 CTGGAGGGACAGATGAGGAAGGG - Intergenic
947029932 2:225782570-225782592 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947077710 2:226363900-226363922 AGGGAGGAACGGAGGGAGGAAGG + Intergenic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
948223315 2:236290311-236290333 CTGGTGGAACAGGTGAGGGAAGG - Intergenic
948228904 2:236335322-236335344 CTGGAGGAAATGCTGGATGAGGG + Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948342549 2:237266435-237266457 GGGGAGGAGGAGATGGAGGAGGG - Intergenic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948458434 2:238118001-238118023 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458442 2:238118030-238118052 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458503 2:238118255-238118277 ATGGAGGAATGGATGGTGGAGGG + Intronic
948458512 2:238118284-238118306 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458630 2:238118715-238118737 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458661 2:238118815-238118837 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458740 2:238119140-238119162 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458754 2:238119183-238119205 GAGGAGGAATGGATGGAGGAGGG + Intronic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
949006674 2:241653383-241653405 CAGGTGGAGCTGATGGAGGAGGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168884375 20:1236228-1236250 CTGGAGGAAGATTTGTAGGAGGG - Intronic
1168955083 20:1828973-1828995 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1169117020 20:3072340-3072362 CTGGAGGAAGAGGTGGAGTCAGG - Intronic
1169206403 20:3742540-3742562 CTGGGGTAAAAGTTGGAGGATGG + Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1170941864 20:20854645-20854667 CAGGAGGAAAAGATTAAGGAGGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172179914 20:32996607-32996629 TTGGAAGAACAGATGGATAAGGG - Intronic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172474900 20:35229204-35229226 AAGGAGGAAGAGGTGGAGGAAGG - Intronic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173550034 20:43926516-43926538 CTGGAGGAAGAAATGAGGGAGGG - Intronic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1174746952 20:53072954-53072976 ATGGAGGGATAGATGGATGAAGG - Intronic
1174746976 20:53073030-53073052 AAGGAGGAATGGATGGAGGAAGG - Intronic
1174747007 20:53073165-53073187 ATGGAGGGATAGATGGATGAAGG - Intronic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175705121 20:61171084-61171106 CTGGAGTTACAGCTAGAGGAAGG - Intergenic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1177673749 21:24269728-24269750 GTGGAGGAAAATCTGGAGGATGG - Intergenic
1178408725 21:32346993-32347015 CTGGAGGTACACATGGATGAGGG + Exonic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179336693 21:40463450-40463472 CTGGAAGAACTGATGGAAGAAGG - Intronic
1179567519 21:42258429-42258451 ATGGAGGAAGATATGGAGGGAGG - Intronic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179885426 21:44312273-44312295 CTGGAGGAGCTGGTGGCGGAAGG + Exonic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181343510 22:22200854-22200876 CTGCAGGAGCATATGGAGGGTGG - Intergenic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1182100769 22:27655915-27655937 CTAGAGGGACAGATGGATGAGGG + Intergenic
1182266222 22:29117706-29117728 CATGAGGAACAAATGGAGAAAGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183509611 22:38227179-38227201 GTGGAGGAAGGGAGGGAGGAAGG + Intronic
1183581234 22:38727791-38727813 CTGGAGGAAAAGGTGGGAGATGG + Intronic
1183771621 22:39931277-39931299 CTGGAAGTACAGAGAGAGGAAGG + Intronic
1183807597 22:40224727-40224749 CGGGAGGAAGAGAGGAAGGAAGG - Intronic
1184095073 22:42312026-42312048 AAGGAGGAAGACATGGAGGATGG + Intronic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184293283 22:43509277-43509299 ATGGACGGATAGATGGAGGATGG - Intergenic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
1185019353 22:48365288-48365310 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
953996052 3:47520908-47520930 CTGGAGGAACAAAAGGGTGAAGG + Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954318282 3:49813122-49813144 CTGGAGGAGCAGCTGAAGGTGGG - Exonic
955072090 3:55580402-55580424 CTGGAAGAAAAGACAGAGGATGG + Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957214248 3:77298759-77298781 CAGGAGGCACAGATGAATGAAGG - Intronic
957444356 3:80295779-80295801 GAGGAGGAAGAGGTGGAGGAGGG - Intergenic
957680190 3:83424018-83424040 GTGGAGTACCAGATGAAGGAAGG + Intergenic
958173836 3:89970271-89970293 GTTGAGCAAAAGATGGAGGAAGG - Intergenic
958255599 3:91321304-91321326 CTGTAGGAACATGTTGAGGAGGG - Intergenic
959392499 3:105793404-105793426 CATAAGGAACTGATGGAGGAAGG + Intronic
960633339 3:119755509-119755531 ATGGAGGAAGAGAGGGAGAAAGG - Intronic
962277943 3:134029990-134030012 CCCGAGGAAAAGAGGGAGGAGGG - Exonic
962288065 3:134105264-134105286 CTGGAGGAACACATGGCTGAAGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
964028116 3:152102968-152102990 TTGGAGGAAGGGAGGGAGGAAGG - Intergenic
964762423 3:160146850-160146872 TTGGAGGAAGAGAAGGTGGAGGG - Intergenic
964890395 3:161527623-161527645 CTTGAGGATAAGATGGAGAAGGG + Intergenic
965039051 3:163482723-163482745 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965296173 3:166949598-166949620 TTGGAGGAAAAGGTGGAGGGTGG - Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965683498 3:171276373-171276395 ATGGAGGAACCTGTGGAGGAGGG + Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
967220595 3:187244988-187245010 TTGGAGGAAAAGATGAAGGAGGG + Intronic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968091013 3:195898196-195898218 CTGGTGGAGAAGGTGGAGGACGG - Intronic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969481408 4:7448863-7448885 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481466 4:7449024-7449046 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481535 4:7449202-7449224 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969522944 4:7689341-7689363 TTGGAGGAACGGATGGAGGATGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970607238 4:17692170-17692192 CGAGAGGAAGAGATGGAGGGAGG + Intronic
971154291 4:24065220-24065242 TTGGAGGAGCAGATGCAGGTAGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
973968920 4:56191396-56191418 AGGGAGGAACAGAGGGAGGGAGG - Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
974474416 4:62361424-62361446 GGGGAGGAACAGATGGTGGGTGG + Intergenic
975126579 4:70789027-70789049 CTGGAGGATCAGATGGGAGGAGG - Intronic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976486153 4:85607369-85607391 AGGGAGGAACGGAGGGAGGAAGG + Intronic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
976903682 4:90209362-90209384 GTAGTGGAACAGATGGTGGAGGG + Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977589927 4:98814747-98814769 TTGGAGGAACAGGTCCAGGAAGG - Intergenic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
978071628 4:104479778-104479800 ACGGAGGAACAGAGGGAGGGAGG - Intronic
979251474 4:118571137-118571159 CTAGAGTAAGAGATGGACGAAGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982783177 4:159512203-159512225 ATGGTGGAACAGATGTAGGCTGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984947722 4:184983064-184983086 ATGGAGGAAGACAGGGAGGAGGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986245684 5:6004619-6004641 CTGTAGGAAAACATGTAGGAAGG + Intergenic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
987387560 5:17344522-17344544 CAGGAGGAAGAGATAGAGGGGGG - Intergenic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988463598 5:31465759-31465781 AGGGAGGAAGAGAGGGAGGAGGG - Intronic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990349064 5:54897746-54897768 GTGGAGGAGGGGATGGAGGAGGG - Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991172306 5:63642628-63642650 AGGGAGGAACAGAGGGAGGGAGG - Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
991646783 5:68808276-68808298 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993001912 5:82389028-82389050 CTGAAGGAGCACATGGAGGGCGG - Intergenic
993629815 5:90272298-90272320 ATAGACTAACAGATGGAGGAAGG + Intergenic
995553702 5:113305540-113305562 CTGGAAGAGAAGATGAAGGAAGG - Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996595622 5:125199355-125199377 GGGGAGGAGAAGATGGAGGAGGG - Intergenic
996684936 5:126269687-126269709 TGGGAGGAACAGATGGGAGAAGG - Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997569388 5:134914541-134914563 ATGGAGGAACAGAGGGACAAGGG + Intronic
997729457 5:136156595-136156617 CTGAAGGAACTGATGAAGAAAGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998815053 5:146005554-146005576 TTGAAGGAAGGGATGGAGGAAGG + Intronic
999904494 5:156124755-156124777 AGGGAGGGACAGATGGAGGGAGG + Intronic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1002121546 5:177008259-177008281 TTGGAGGATCAGTTGGAGGTAGG - Intronic
1002170154 5:177370462-177370484 CTAGAGGAAGGGATGGAGGGTGG - Intronic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1003306483 6:4933562-4933584 CTGGAGGAACAGATTAGAGAGGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1003978300 6:11365022-11365044 CTGGAGCAAGAGTTGGAGGTGGG + Intronic
1004040036 6:11966381-11966403 TAGGAGGTACATATGGAGGATGG - Intergenic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005070921 6:21861568-21861590 ATGGTGGAAGAGATGGAAGAGGG + Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006436489 6:34028355-34028377 CTGGATGTACAGCTGGCGGAGGG + Exonic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1010009674 6:71035941-71035963 CTGGAGGAAGACTTGGAGGCTGG + Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1012225105 6:96694524-96694546 GGGGAGGAACAGATGGTGGGTGG - Intergenic
1012270233 6:97200336-97200358 AGGGAGGAAAAGATAGAGGAGGG + Intronic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014103867 6:117541510-117541532 AAGGAGGAACAGAGGTAGGAGGG + Intronic
1014241172 6:119019153-119019175 GTAAGGGAACAGATGGAGGAGGG + Intronic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1015427155 6:133084386-133084408 CTGGAGTAACACATGAAGGATGG - Intergenic
1016317757 6:142808706-142808728 ATGGAGGAAAGGATGGGGGAGGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017120637 6:151020905-151020927 CTGGAAGAACGTATGGAGGAGGG - Intronic
1018088697 6:160327166-160327188 TGGGAGGAAAAGATGGAGGGAGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019730600 7:2627454-2627476 AGGGAGGAAAAGATGGAGGGAGG + Intergenic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1020331848 7:7026519-7026541 TTGGAGGAACAGATGGTGTTTGG + Intergenic
1021239573 7:18183533-18183555 GTGGGGGAAAAGATGGAGTAAGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022959849 7:35416005-35416027 CTCTAGGAAGAGATGGAGGCTGG - Intergenic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024004348 7:45214486-45214508 CAGGAGGAAAAAATGGAGGGAGG + Intergenic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024956384 7:54925856-54925878 GTGGAGGAACAAATGGTGTAAGG - Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026611658 7:71865306-71865328 CTGGAGGAAGAGATAGAGAGGGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1028529167 7:91819138-91819160 CTGGGGGAAAAGGTGGAGGGAGG - Intronic
1028770319 7:94612776-94612798 AAGGAGGAACAGGTGGAGGTGGG - Intronic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029478452 7:100799185-100799207 AGGGAGGAAAGGATGGAGGAAGG - Intergenic
1030099879 7:105936418-105936440 ATGGTGGAAGGGATGGAGGATGG - Intronic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1031205486 7:118751819-118751841 GCAGAGGAACAGATGCAGGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032963437 7:137067403-137067425 CTGGAGGAATAGATGCAGTTGGG + Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035049530 7:155990509-155990531 CTGGAGGAGCAGCTGGGGAAGGG + Intergenic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1036069449 8:5424507-5424529 CTGCAGGAACATATGAAGTATGG + Intergenic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036487235 8:9190237-9190259 CTTGAGGAAAGGATGGAGGATGG - Intergenic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037426605 8:18762264-18762286 CAGGAGGAAGAGAGGAAGGAAGG - Intronic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037644230 8:20775762-20775784 CTGAAGGAACAGGTGGTGGCTGG + Intergenic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1038017970 8:23530538-23530560 CTGGAGGGACATATGGGTGATGG - Intronic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1039986568 8:42452680-42452702 AAGGAGGAAAAGATGGAGGAGGG + Intronic
1040071928 8:43195630-43195652 GTGGAGGAAGAGGAGGAGGAGGG + Intronic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040570486 8:48605048-48605070 CTGGAGGAGAGGTTGGAGGAGGG + Intergenic
1040776077 8:51044674-51044696 CTGGATGATGAGATAGAGGATGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041741148 8:61158311-61158333 CTGGAGGAACAGACTGGGAAGGG + Intronic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1042110407 8:65375731-65375753 CTGGAGGAAGAGATGCAGCCAGG - Intergenic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045411977 8:101929246-101929268 GAGGAGGAAGGGATGGAGGAAGG + Intronic
1045411982 8:101929258-101929280 ATGGAGGAAGGGATGGAGGGAGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047623034 8:126627732-126627754 CCTGAGGAACATATGGAGAAAGG - Intergenic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1048151252 8:131896971-131896993 TTGGAGGAAGAGAGGGAGGGAGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048452361 8:134544647-134544669 CTAGAAGAAAAGGTGGAGGAGGG + Intronic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1048988731 8:139749133-139749155 AGGGAGGGACAGATGGAGCAGGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1049478835 8:142810453-142810475 GTGGAGGAAGGGAAGGAGGAAGG - Intergenic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1049989872 9:980860-980882 CTGGAGGAAAAGTTGGGGGTAGG - Intronic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1051182548 9:14426654-14426676 CTAGAGGAATGGTTGGAGGAAGG - Intergenic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1051357710 9:16254892-16254914 GAGGAGGAAGAGGTGGAGGAAGG + Intronic
1051694321 9:19751794-19751816 CTGGAGGATCAGACGTAGGAAGG + Intronic
1052502808 9:29314111-29314133 CGGGAGGAAGAGAAGGAGGGAGG + Intergenic
1052972093 9:34382813-34382835 CTGGTACAACACATGGAGGATGG - Exonic
1056159471 9:83874085-83874107 CTGGAGCAACATGTGGAAGAGGG - Intronic
1056238314 9:84618048-84618070 TAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056351100 9:85749840-85749862 CTGGAGCAACATGTGGAAGAGGG + Intergenic
1056458110 9:86782935-86782957 CTGGAGGAAGACATAGAGGTCGG - Intergenic
1056719414 9:89059633-89059655 GTGGAGGACGTGATGGAGGATGG + Intronic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057642908 9:96844574-96844596 GTGGAGGAAGGGATGGAGGGAGG + Intronic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058053555 9:100428487-100428509 CTGGAGGAAGATGTAGAGGAAGG + Intronic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058955265 9:109941049-109941071 AGGGAGGAAAAGATGGGGGAAGG - Intronic
1059613573 9:115924694-115924716 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059613578 9:115924710-115924732 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059675823 9:116538185-116538207 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061080060 9:128364724-128364746 CTGGAGGAACAGTTTGCAGATGG - Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061634918 9:131901527-131901549 CTTGAGGAACGGAGGGAGGAGGG + Intronic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1061865706 9:133490898-133490920 GAGGAGGAAAAGGTGGAGGAGGG + Intergenic
1061963340 9:133999038-133999060 GTGGAGGGATAGATGGAGGGAGG - Intergenic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1186107134 X:6219604-6219626 ATGGAGGAACGAAGGGAGGAAGG - Intronic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1187723669 X:22179347-22179369 TTGGGGGAACAGATGGTGGTTGG + Intronic
1187777103 X:22772890-22772912 GTGGAGGAACAGAGGGATCATGG + Intergenic
1187813161 X:23202815-23202837 CAGGAGGGACAGATAGAGGCAGG + Intergenic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1189302109 X:39959662-39959684 CAGCAGGGAAAGATGGAGGAGGG + Intergenic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190739564 X:53280260-53280282 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1191666329 X:63706415-63706437 CAGGAGGATGAGGTGGAGGAGGG - Exonic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193430145 X:81392057-81392079 CTGGTGGAACAGCTGGGAGATGG + Intergenic
1195803008 X:108734404-108734426 CTGGAGGAACTGGTGGAAAAGGG - Exonic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196548546 X:116994878-116994900 GAGGAGGAAAAGATGGAGAAAGG + Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200070412 X:153526295-153526317 CTGGAGGAGCAGCTGGTGGTGGG + Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic