ID: 1167194073

View in Genome Browser
Species Human (GRCh38)
Location 19:48014787-48014809
Sequence CATTATTAGCATTCATTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167194073_1167194078 29 Left 1167194073 19:48014787-48014809 CCTGACAATGAATGCTAATAATG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1167194078 19:48014839-48014861 AAATAGTGCTCTCTGGATGAGGG 0: 1
1: 0
2: 2
3: 13
4: 157
1167194073_1167194077 28 Left 1167194073 19:48014787-48014809 CCTGACAATGAATGCTAATAATG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1167194077 19:48014838-48014860 AAAATAGTGCTCTCTGGATGAGG 0: 1
1: 0
2: 0
3: 14
4: 173
1167194073_1167194076 22 Left 1167194073 19:48014787-48014809 CCTGACAATGAATGCTAATAATG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1167194076 19:48014832-48014854 GTGTTAAAAATAGTGCTCTCTGG 0: 1
1: 1
2: 0
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167194073 Original CRISPR CATTATTAGCATTCATTGTC AGG (reversed) Intronic
901308750 1:8252669-8252691 CTTTATTTGCATTCAATGACTGG - Intergenic
903395128 1:22995266-22995288 CATTATTAGGGTTTATTGTTTGG + Intergenic
906055517 1:42913231-42913253 CTTTATCAGCACTCAGTGTCAGG - Intergenic
909883960 1:80916597-80916619 AATTATTAGCATTATTTTTCAGG - Intergenic
909954429 1:81761408-81761430 TATTAATAGCATTAATTATCAGG + Intronic
910399751 1:86826667-86826689 CCTAATAAGCATTCTTTGTCAGG + Intergenic
910776540 1:90882012-90882034 CAGTATTAGCCATCATTGTCAGG + Intergenic
911144145 1:94536268-94536290 CATCATTAGGATTGATTGTAGGG - Intronic
912069408 1:105789984-105790006 CATTATTATAATTTATTTTCAGG - Intergenic
913011830 1:114690997-114691019 CAGAACAAGCATTCATTGTCTGG + Intronic
916703935 1:167326786-167326808 CTTTGTTAGCAATGATTGTCTGG + Intronic
917092544 1:171368187-171368209 CATTTTTAGAATTCCTTGTTTGG - Intergenic
917214790 1:172666730-172666752 CACTATTAGAGTTGATTGTCAGG - Exonic
917701900 1:177590137-177590159 CATCATTATCATTCCTTTTCTGG + Intergenic
918564169 1:185907436-185907458 CTTTATGACCATCCATTGTCTGG + Intronic
921475289 1:215599821-215599843 CATTTTTACCATTTATTCTCTGG - Intronic
922094038 1:222426024-222426046 CATTTTTAGCATTTCTTGTAGGG - Intergenic
922279869 1:224113809-224113831 CATCTTTATCATCCATTGTCAGG + Intergenic
923507828 1:234621471-234621493 CCTTATTAGTATGCATTTTCTGG - Intergenic
924520003 1:244797790-244797812 CAATATTAACATTCCTTGACAGG - Intergenic
1066113523 10:32219300-32219322 CATTATTAGTATTCCTTGCTGGG - Intergenic
1067124660 10:43506105-43506127 GATTTTTAGCATTTCTTGTCAGG + Intergenic
1067940523 10:50651179-50651201 CATTATTAGCATAGACTATCTGG - Intergenic
1073568640 10:104557135-104557157 CAGTATCACCATTCATTGTGTGG - Intergenic
1075311481 10:121417539-121417561 TATTTTTAGAATTCATTGCCAGG - Intergenic
1082077766 11:47987609-47987631 CATTATCACCATTCCTTCTCTGG - Intronic
1082257718 11:50051040-50051062 AATTATTAACATTCCTTGCCAGG - Intergenic
1086918278 11:92556470-92556492 GATTATGAGAATTCAGTGTCAGG - Intronic
1088659724 11:112033636-112033658 AATTCTTAGGATTCATTTTCTGG + Intronic
1089464656 11:118677090-118677112 CATTATTAGCATCAAATATCTGG - Intronic
1091002101 11:131918279-131918301 CATTGAAAGCATTCATGGTCAGG - Intronic
1092576207 12:9785476-9785498 CTTTATTAGCCTTTATTGTTTGG + Intergenic
1093822067 12:23632828-23632850 TATTAGTAGCATGCATTCTCTGG - Intronic
1095198477 12:39353575-39353597 CATTCTTAGCATTCATTATTAGG - Intronic
1095732044 12:45516688-45516710 TATTATTAGCATTCTTTTGCAGG - Intergenic
1097443124 12:59635312-59635334 CCTTATTAACATTGATTGCCTGG + Intronic
1098716717 12:73836077-73836099 CTTTATCAGAATTCAGTGTCAGG + Intergenic
1099949581 12:89286494-89286516 CATTATTTGCTTTGATTATCAGG - Intergenic
1100702153 12:97160448-97160470 CATTGTTAGCATACACTGTCTGG + Intergenic
1105739543 13:23309065-23309087 AATTATTAGAATTCATTACCAGG + Intronic
1105823705 13:24103090-24103112 CATTCTTGGGTTTCATTGTCAGG + Intronic
1105994434 13:25656635-25656657 TATTATTAACATACATTTTCTGG + Intronic
1106312631 13:28567182-28567204 CATCATAAGCATTCAATTTCAGG - Intergenic
1107145918 13:37060112-37060134 CATTACTAGCACACATTGTAAGG + Intergenic
1108936667 13:55890714-55890736 CATAATTCCCATTCATTGTGGGG - Intergenic
1108945375 13:56016627-56016649 CATTATTGGATTCCATTGTCTGG + Intergenic
1109250483 13:60013725-60013747 CTTTATTAGCATTCATTGAATGG - Intronic
1109513302 13:63406931-63406953 CATTTTTAGCATAAATTATCTGG + Intergenic
1110186798 13:72684486-72684508 CATTATTAGCGATCATTATTAGG + Intergenic
1111032823 13:82629220-82629242 CATTATTTGCATTCACAGGCTGG - Intergenic
1111603363 13:90503004-90503026 CATTGTTAGCATAAACTGTCTGG - Intergenic
1111652074 13:91103944-91103966 CATTCATTGCATTCATTGCCTGG + Intergenic
1115455200 14:33593960-33593982 CATAATAATCATTCATTATCAGG + Intronic
1115683862 14:35772610-35772632 CCTTATTAGCATTCATTTAATGG - Intronic
1116088227 14:40268906-40268928 AATTACTAGCATTCACTGTTAGG - Intergenic
1116157945 14:41232098-41232120 TATTAGTAGCCTTCATTGTAAGG - Intergenic
1116276913 14:42846392-42846414 TATTTGTAGTATTCATTGTCTGG + Intergenic
1116338365 14:43689028-43689050 CATTATTAGCATACATTAAGTGG - Intergenic
1118033543 14:61841262-61841284 CATTCTTAGCAGACATTGTATGG + Intergenic
1120927046 14:89808172-89808194 TATTATTAACATTCATTGCCAGG - Intronic
1122453721 14:101833540-101833562 CATTTTTTGCTCTCATTGTCTGG + Intronic
1124714328 15:32045290-32045312 CATTTTTCCCATACATTGTCTGG - Intronic
1125053567 15:35330784-35330806 AATGATTAGCATTGACTGTCTGG - Intronic
1125397555 15:39266090-39266112 TATGATTTGCATTCATTGTGGGG + Intergenic
1126432019 15:48596411-48596433 CTTCATTAGCATTTATTTTCAGG - Intronic
1126476117 15:49066924-49066946 CCTTATAAGCTTTCAATGTCTGG - Intergenic
1127849708 15:62902005-62902027 CATTATTACCAGTCAGTGACTGG + Intergenic
1128487275 15:68106282-68106304 CATTTTTAGCCTTCATGGGCAGG - Intronic
1129791571 15:78344101-78344123 CCAAATTAGCATTCATTGCCTGG - Intronic
1129918738 15:79299669-79299691 TATTTTTAGCATTCATTGCCAGG - Intergenic
1136703803 16:32168763-32168785 CATCATTAGCATAAATTGCCTGG - Intergenic
1138922725 16:61552258-61552280 TATTATTTCCATTCATAGTCTGG + Intergenic
1139033524 16:62914764-62914786 TATTATTAGCAGACATTTTCAGG - Intergenic
1140292253 16:73670846-73670868 CCTTATTAGCATACTTTGCCTGG - Intergenic
1140617768 16:76687872-76687894 CTTTATTATAATTCTTTGTCTGG - Intergenic
1203066253 16_KI270728v1_random:1020965-1020987 CATCATTAGCATAAATTGCCTGG + Intergenic
1147644076 17:42023375-42023397 CATTATTAGCAGTCAGTTTCTGG - Intronic
1153838654 18:8986902-8986924 CATGATTATCTTTCATTGTATGG - Intergenic
1155600123 18:27535986-27536008 TATTATTATCATTGATTCTCAGG - Intergenic
1158144640 18:54298455-54298477 CATCATTAGCATACAGTGTCAGG + Intronic
1158839191 18:61365264-61365286 CATTATGAACATTCATTATTGGG + Intronic
1159000086 18:62965799-62965821 CATTCTTAGCATTTCTTTTCTGG - Intronic
1159809522 18:72999758-72999780 CACTTTCAGCATTCATTGTTTGG + Intergenic
1167194073 19:48014787-48014809 CATTATTAGCATTCATTGTCAGG - Intronic
926348670 2:11974944-11974966 CATTATTTTCATTCTTTGTCTGG + Intergenic
928396729 2:30948393-30948415 CATTGTTAGCATAGATTATCTGG - Intronic
930677585 2:54220913-54220935 AAATTTTAGCATTCATTGTTGGG + Intronic
931292379 2:60885106-60885128 CCTAATTATGATTCATTGTCTGG - Intronic
935680779 2:105635241-105635263 CATCACTAGCATTCATTCTTGGG - Intergenic
936687980 2:114850504-114850526 CATTATTAGCATACATCATTAGG + Intronic
938881272 2:135592199-135592221 CCTCATTAGCATACATTATCAGG + Intronic
939062496 2:137439855-137439877 CATGATTACAAATCATTGTCTGG + Intronic
939488274 2:142844685-142844707 AATTTTTACCATTCATAGTCAGG + Intergenic
940663044 2:156571525-156571547 CATTATTATCTTTCTTTTTCAGG - Intronic
942659821 2:178252715-178252737 AAGTATTAGCATTAATTGTAAGG - Intronic
942682424 2:178491429-178491451 TATTGTTAGTATTCATTGGCTGG + Intronic
944639008 2:201703179-201703201 AATAATTAGAATTCAATGTCAGG - Intronic
945165883 2:206944271-206944293 CATTCTTAACATACATTTTCAGG - Intronic
946630844 2:221667035-221667057 CATTAATAGCAGTAATTGGCTGG + Intergenic
947484313 2:230534068-230534090 CTTTATTAGGTTTCATTGTTTGG + Intronic
1180761855 22:18216646-18216668 GATTATTTGAATTCTTTGTCAGG - Intergenic
1180773812 22:18407964-18407986 GATTATTTGAATTCTTTGTCAGG + Intergenic
1180805164 22:18657508-18657530 GATTATTTGAATTCTTTGTCAGG + Intergenic
1180805582 22:18711900-18711922 GATTATTTGAATTCTTTGTCAGG - Intergenic
1181069871 22:20326678-20326700 GATTATTTGAATTCTTTGTCAGG + Intergenic
1181192914 22:21154889-21154911 GATTATTTGAATTCTTTGTCAGG + Intergenic
1181216527 22:21337685-21337707 GATTATTTGAATTCTTTGTCAGG - Intergenic
1181953484 22:26571483-26571505 CATATTCTGCATTCATTGTCTGG + Intronic
1183794263 22:40102357-40102379 CCTTATTAGGATTCATTATTTGG + Intronic
1184833732 22:47007953-47007975 CATCATTATCATTCATTAGCAGG + Intronic
1184971408 22:48023969-48023991 CATCACTAGCATTCTTTGTGGGG + Intergenic
1203235644 22_KI270731v1_random:148938-148960 GATTATTTGAATTCTTTGTCAGG + Intergenic
949523676 3:4881438-4881460 CATAAGTTGCATTCATTGTAGGG - Intronic
951586188 3:24217448-24217470 AAGTAATAGCATTCATTGACTGG - Intronic
952129504 3:30344272-30344294 CATAATTATCATTCATTTTTTGG + Intergenic
956625462 3:71262324-71262346 TATTCTTAGCATTGAGTGTCTGG - Intronic
957378858 3:79397730-79397752 CTTTATTATCATTAATTGCCTGG - Intronic
957540432 3:81562383-81562405 CAACATTAGCATTCATTTTTGGG + Intronic
959965800 3:112353513-112353535 CATTGTTATTATACATTGTCAGG - Intronic
960458483 3:117903013-117903035 GCTTAAAAGCATTCATTGTCAGG - Intergenic
963666285 3:148191996-148192018 CCTTATTCGCATTCTTTGGCAGG - Intergenic
963929516 3:150989006-150989028 CATTATTAGATTTAAATGTCTGG - Intergenic
966148739 3:176842594-176842616 CATCATTAGCACAAATTGTCTGG - Intergenic
966650381 3:182294413-182294435 CATGATTAGCCTTCAATGTTAGG + Intergenic
966653089 3:182323361-182323383 CAATATTAGAATTTATTGTCAGG + Intergenic
967053543 3:185807281-185807303 CATTTTTAGCATTCAACCTCAGG - Intronic
967587732 3:191235291-191235313 CTTTATTAGTATTCATGGTTTGG - Intronic
967683807 3:192396747-192396769 CATTATTTGAATTCAAAGTCTGG - Intronic
970430842 4:15987594-15987616 CATTTCTAGCATTCTTTGTGTGG + Intronic
970977145 4:22055405-22055427 CATTATTTACATTTATTGCCAGG + Intergenic
974230171 4:59102421-59102443 CAGAATTAGCTGTCATTGTCAGG + Intergenic
975935847 4:79579060-79579082 CATTATTAGCATGCAGTGCTGGG + Intergenic
976273648 4:83254455-83254477 TATTATTAACATTCATGGACAGG + Intergenic
976331381 4:83834779-83834801 CTTTATTAGACTTCATTCTCAGG + Intergenic
984454512 4:179947294-179947316 CAGTATTTGTCTTCATTGTCTGG - Intergenic
986585337 5:9311109-9311131 CACTGTTAGCATTCAGAGTCAGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991133324 5:63151899-63151921 CATCATTAGTATACATTATCTGG + Intergenic
993684228 5:90918393-90918415 CATTATTAGGTTTCAATGTTCGG + Intronic
994121872 5:96123497-96123519 CATTATTGGCATGCATTTTAAGG + Intergenic
994156801 5:96513076-96513098 CCTGATTATCATTCATTCTCGGG + Intergenic
997113978 5:131105611-131105633 CAGGATTTGCTTTCATTGTCTGG - Intergenic
998933916 5:147213873-147213895 TATTATTAGCATTGAATGACAGG + Intergenic
1000719237 5:164685392-164685414 CATACTTAGTATTCATTCTCTGG + Intergenic
1001246982 5:170112140-170112162 AAATACTAGCAGTCATTGTCTGG + Intergenic
1003400988 6:5790657-5790679 AAATATTAGCAGTCATGGTCAGG + Intergenic
1004104650 6:12654641-12654663 CATTGTTAGCATGGACTGTCTGG - Intergenic
1007287277 6:40756624-40756646 CATTTCTAGCATTTAGTGTCTGG - Intergenic
1007813961 6:44506934-44506956 CAATATTAGCATTTATTCACTGG - Intergenic
1009641049 6:66337311-66337333 CATAATAAGCTTTCATTGACTGG + Intergenic
1012199514 6:96388122-96388144 CATGAACAGCATTCATTGTTAGG - Intergenic
1014609826 6:123527967-123527989 CATAATAAGTATTCATTGCCTGG + Intronic
1014750336 6:125248133-125248155 CACTGTTTCCATTCATTGTCTGG - Intronic
1015779852 6:136853759-136853781 CATTACTAGTATTCATTATTAGG - Intronic
1020047176 7:5049057-5049079 CATCATTTGCATTCATTATAAGG + Intronic
1022917557 7:34973816-34973838 CATTAATATCATGAATTGTCAGG + Intronic
1027122043 7:75528759-75528781 CTTTGTCAGCACTCATTGTCAGG + Intergenic
1027814234 7:82949084-82949106 CATAATTAATATTCATTTTCAGG - Intronic
1028339278 7:89697800-89697822 CTTTATTAGCTTCCATTGGCAGG - Intergenic
1029210092 7:98900689-98900711 CATTTTTAGCTTACATTATCAGG + Exonic
1030023610 7:105300069-105300091 CAGTATTAGCAATAATTGGCCGG + Intronic
1031570738 7:123356267-123356289 CTTTATGAGCATTCATAGTCAGG - Intergenic
1032859826 7:135866329-135866351 CATCATCACCATGCATTGTCCGG + Intergenic
1037005607 8:13775941-13775963 CATTATTAGCATTGTTTCTATGG + Intergenic
1039187088 8:34929848-34929870 CAGTATTAACAATCATGGTCAGG + Intergenic
1040995554 8:53397651-53397673 CATTATTTACATTCATTATATGG - Intergenic
1041174850 8:55184966-55184988 AATGATTGGCATTCATTGTTGGG - Intronic
1047425736 8:124744313-124744335 CATTATTAGTTTTCTTTCTCTGG + Intergenic
1051231098 9:14956586-14956608 CATTATTAGGACCCACTGTCAGG + Intergenic
1053484435 9:38441478-38441500 GATTGTTAGCATTCAATGCCTGG + Intergenic
1056791785 9:89630465-89630487 CATTGTTTTCAGTCATTGTCTGG - Intergenic
1057545269 9:96015482-96015504 CTTTAATAGCATTTATTGGCTGG - Intergenic
1185782048 X:2856246-2856268 CAATTTTAGCATTCATTCTGGGG + Intronic
1186278848 X:7970694-7970716 CATGATTAGAATTACTTGTCAGG + Intergenic
1189002703 X:36963436-36963458 CATTTGTAGCATTGATTTTCCGG - Intergenic
1193428286 X:81367923-81367945 AATTATTAGCATACATAGGCTGG - Intergenic
1195020065 X:100818496-100818518 CATTATTGGCATTCAGTGGGGGG + Intergenic
1200895549 Y:8372481-8372503 GATTAATAGTATTCATTGCCTGG - Intergenic