ID: 1167196829

View in Genome Browser
Species Human (GRCh38)
Location 19:48034919-48034941
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120283
Summary {0: 1, 1: 74, 2: 2626, 3: 30174, 4: 87408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167196829 Original CRISPR CTTTGGAAGGACAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr