ID: 1167198656

View in Genome Browser
Species Human (GRCh38)
Location 19:48048751-48048773
Sequence AAGCTGTTATTGCTGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167198656_1167198661 12 Left 1167198656 19:48048751-48048773 CCCTGATCCAGCAATAACAGCTT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1167198661 19:48048786-48048808 TCGAATAGACTGATATAGTTTGG 0: 1
1: 0
2: 0
3: 18
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167198656 Original CRISPR AAGCTGTTATTGCTGGATCA GGG (reversed) Intronic
900643894 1:3700045-3700067 AAGCTGTTATTGCTGTCTACGGG + Intronic
901439046 1:9266399-9266421 AAGCAGGTATTGCTGGCCCATGG - Exonic
902145530 1:14395683-14395705 AGGCTGACATTTCTGGATCAAGG - Intergenic
903814413 1:26054202-26054224 AAGCTGCTGTTGCTGGAGCAAGG - Intronic
906079904 1:43079128-43079150 AAGATGTTATTGCGAGATTAAGG + Intergenic
908426687 1:64014387-64014409 AAGCTACTATTGATGGGTCAAGG + Intronic
909387916 1:75081477-75081499 TAGCTATTATTAATGGATCAGGG - Intergenic
916308025 1:163361507-163361529 AAGCTGATGTTGTTGGTTCAGGG + Intergenic
917184222 1:172334668-172334690 AAGCAGTTACTGCTGAAACATGG - Intronic
917633509 1:176913618-176913640 AAGCGATTATTGCTGGGGCAGGG + Intronic
920511456 1:206555460-206555482 GAGCTGTTATTGATGGCCCAAGG + Intronic
922036126 1:221850316-221850338 AATATGTTATTTCTGGATTATGG - Intergenic
1065368210 10:24954852-24954874 GAGCTGTTATTTCTGGATACCGG - Intergenic
1068589143 10:58835958-58835980 AAGCATTTATTCCTGGTTCACGG - Intergenic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1070717029 10:78729852-78729874 TACCTGTTAATGCTGGATGAAGG - Intergenic
1070913580 10:80138401-80138423 ATGGTGTTATTGCTGAATCTGGG - Intronic
1071751310 10:88479606-88479628 CAGCTGTTATTTCTAGTTCAAGG - Intronic
1072095163 10:92171230-92171252 AAGGTGTTTTTGAAGGATCAGGG - Intronic
1074543651 10:114386072-114386094 AAGCTGTTACTACTGGATGGTGG - Intronic
1074793834 10:116920746-116920768 AAGTTGGTATGGCTGGAACATGG - Intronic
1075379361 10:122006025-122006047 AAGCTGTTCTTCATGTATCAAGG - Intronic
1076080297 10:127574182-127574204 AAGCTTTTGTTGTTGGATTAAGG + Intergenic
1076510005 10:131006602-131006624 AAGCTGGTATTCCTAGGTCAGGG - Intergenic
1079441969 11:20524081-20524103 AAGCTGAGAGTGGTGGATCACGG - Intergenic
1080051842 11:27865925-27865947 AAACTATTATTGGTGCATCATGG - Intergenic
1087889530 11:103520952-103520974 AAGCTGTTAAAGATGTATCATGG + Intergenic
1088748556 11:112824614-112824636 AAGATTTTATTGCTGGATGGAGG - Intergenic
1089222724 11:116888305-116888327 CAGCTGCTATTGCTGTATTACGG - Intronic
1089760864 11:120722175-120722197 AAGTTGCTATTGCTGAATGAGGG - Intronic
1090750395 11:129741785-129741807 AAGGTGTCATTGCTGGGTCAAGG + Intergenic
1097772237 12:63601244-63601266 AAACTGTTATTTCTTGATGATGG - Intronic
1098100752 12:67014108-67014130 GTGCTGTTATGGCTTGATCAGGG - Intergenic
1098701400 12:73632402-73632424 ATGCTGTTGTTGCTGGTCCAGGG - Intergenic
1099463291 12:82950462-82950484 TAGTTGTTATTGTTGGATCTAGG - Intronic
1101115979 12:101531761-101531783 AAGCTGATAATGCTGGGTAAAGG + Intergenic
1101260763 12:103027313-103027335 AAGCTTTTCTTGCTTGTTCAAGG - Intergenic
1101747519 12:107554750-107554772 AGGCTGTTGCTGCTGGTTCAGGG + Intronic
1101980006 12:109397821-109397843 AAGCTCCTATTACTGGTTCATGG + Intronic
1105050614 12:133047154-133047176 AAGATTTTATTGGTGGTTCAGGG + Intronic
1105651905 13:22388076-22388098 AGGCTGTGAATGCTGCATCAAGG + Intergenic
1108094272 13:46884096-46884118 CAGCTGTTATAACTGCATCATGG - Intronic
1108352315 13:49598686-49598708 AAAATGTTATTGCAGTATCAAGG + Intergenic
1108422867 13:50268359-50268381 AAGCTGTTATTAATAGAACATGG - Intronic
1108463318 13:50690064-50690086 AAGCCTTTATTGCTGGATAATGG + Intronic
1109450129 13:62502639-62502661 AAGAAGTTATTGATGGTTCACGG - Intergenic
1109853987 13:68105150-68105172 AGGCTGTTCTTACTGAATCAAGG + Intergenic
1111727631 13:92032596-92032618 CAGATCTTAATGCTGGATCAGGG - Intronic
1112422266 13:99263270-99263292 AAGGTTTTATAGCTGGATCCTGG + Intronic
1114809778 14:25884203-25884225 AAGAAGTTGTTGCTGGATTAAGG + Intergenic
1116036045 14:39628025-39628047 AAGCTGCTATTGCCTGAACAAGG + Intergenic
1116576983 14:46587519-46587541 AAGCTCATATTGCTGTCTCATGG - Intergenic
1117648028 14:57872948-57872970 ATGCTGTGATTGGTGGAGCAGGG - Intronic
1120594735 14:86419640-86419662 AAGCTGCTATTGCTGGAAATGGG - Intergenic
1122188760 14:100023144-100023166 AAGCTGTTCTAGCTGGCTCTTGG + Intronic
1124480350 15:30073972-30073994 AAGGGATTATTGCTGGCTCAGGG + Intergenic
1124522500 15:30416359-30416381 AGGCTGTTATTTCAGTATCAAGG - Intergenic
1124536164 15:30549855-30549877 AGGCTGTTATTTCAGTATCAAGG + Intergenic
1124639604 15:31389089-31389111 AAGCTGATCTTGCTGTCTCAGGG - Intronic
1124762488 15:32457736-32457758 AGGCTGTTATTTCAGTATCAAGG - Intergenic
1124776140 15:32591335-32591357 AGGCTGTTATTTCAGTATCAAGG + Intergenic
1126705474 15:51401539-51401561 AAGCTGTGATTGCTGGAGGTAGG + Intronic
1127342048 15:58057043-58057065 AAAGTGATATTGCTGGCTCATGG - Intronic
1127644130 15:60943439-60943461 GAGATGTTATTTCTTGATCAGGG + Intronic
1128983195 15:72200894-72200916 AGGCTGATCTTGCTGGGTCAAGG - Intronic
1133132456 16:3685761-3685783 CAGTAGTTATTGCTGGATGATGG + Intronic
1133964646 16:10521713-10521735 AATCTGTTACTGCTAGAACATGG - Intergenic
1135195931 16:20394671-20394693 AAGCTGACATTGCTGGCTTATGG + Intronic
1139502520 16:67379048-67379070 TGGAAGTTATTGCTGGATCATGG - Intronic
1140936746 16:79678207-79678229 AAACTGGTATTGCTGGGTCCTGG + Intergenic
1144138078 17:12318409-12318431 ATGCTGATATTGCTGGTCCAAGG - Intergenic
1144261997 17:13530677-13530699 AAGCTGATAGTCCTGAATCATGG + Intronic
1144272076 17:13627513-13627535 TAGCAGTAATTGCTGGATCATGG + Intergenic
1144396273 17:14846320-14846342 AAGCTCTTATTTCTGGCTTAAGG - Intergenic
1146328600 17:31908636-31908658 AAGCTGGCATTTCTGGAGCAAGG - Intergenic
1148146615 17:45369585-45369607 AATCTGTCATTGCTGGAGCTGGG + Intergenic
1150057158 17:62028531-62028553 AAGCTTTTATTTTTGGTTCAGGG - Intronic
1151262021 17:72923562-72923584 AATGTGTTACTGCTGGATCACGG - Intronic
1156025165 18:32645305-32645327 CAGAGGTTATTGCAGGATCATGG - Intergenic
1157808030 18:50672768-50672790 CACCCTTTATTGCTGGATCAAGG + Intronic
1158866942 18:61647116-61647138 CAGATGTTATAACTGGATCAAGG + Intergenic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1158950384 18:62488891-62488913 AAGCTTATATTGCTTTATCAAGG - Intergenic
1159149671 18:64505145-64505167 AAGCTGGAATGGCTGGAACATGG - Intergenic
1160000447 18:75014856-75014878 TAGCTATTATTGTTGGAACATGG - Intronic
1164789619 19:30964952-30964974 AAGCTTTCATTGTTGGATCTGGG - Intergenic
1166068485 19:40374167-40374189 ATGCTGTTGCCGCTGGATCAGGG + Intronic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
1168379324 19:55906853-55906875 ATGCTGCTCTTGCTGGATCATGG - Intronic
926758832 2:16258895-16258917 AAGTAGTTATTGCTGGGTGATGG - Intergenic
927015227 2:18952428-18952450 AAACTTTTATTGCTGGATAGTGG - Intergenic
927290634 2:21401745-21401767 ATGCTGATACTGCTGGTTCAAGG + Intergenic
927850978 2:26499121-26499143 GAGATGTTCTTGGTGGATCAAGG - Intronic
928034054 2:27805447-27805469 AAGCTCTTATGCCTGGAACATGG - Intronic
928552590 2:32387627-32387649 TAGTTGCTATTGCTGGATTATGG + Intronic
929020723 2:37549992-37550014 CAGCTGTTAGTGCTGGAGAAAGG - Intergenic
930527942 2:52554750-52554772 ATGCTGATATTGCTGGTCCAGGG - Intergenic
931138769 2:59434066-59434088 AAGCTGCTACTTCTGGATAAAGG + Intergenic
935935676 2:108180423-108180445 AAGCTGATGCTGCTAGATCAGGG + Intergenic
936111902 2:109671480-109671502 AAGCTGTGGTTGCTGCACCATGG + Intergenic
936662725 2:114560180-114560202 AAGCTATTATTGGTGAACCATGG + Intronic
936716035 2:115188780-115188802 AAAGTGTGATTGCTGGGTCAAGG - Intronic
938265985 2:129928640-129928662 ATGGTGTTATTGCTGAATCTGGG + Intergenic
938657118 2:133445898-133445920 AAGACCTTATTGCTGGACCAAGG + Intronic
939220999 2:139301471-139301493 ATGCTGATAATGCTGGATCAAGG - Intergenic
941379372 2:164774336-164774358 AAGCTGGTATTTCTGTTTCATGG + Intronic
942506062 2:176642803-176642825 TGGCTGTTATTGCTGGGACAGGG + Intergenic
943268077 2:185763128-185763150 AAGCTGATATTGCTGGGACAAGG - Intronic
943417077 2:187620748-187620770 AAGCTGGTCTAGCTGGGTCAAGG + Intergenic
943653210 2:190479156-190479178 AAGCCTTTATTGGGGGATCAAGG + Intronic
944083508 2:195817367-195817389 AAGCTGTTTTTACTGGAGCATGG - Intronic
944266958 2:197738397-197738419 AAGATGTTACTGCTGAATTAGGG + Intronic
945848932 2:214982272-214982294 TAGCTCTCATTGGTGGATCAAGG - Exonic
946096575 2:217279602-217279624 ATGCTTTTGTTGCTGGATCTTGG - Intergenic
946993769 2:225367042-225367064 ATGCTGGTATGGCTGGTTCATGG + Intergenic
948812993 2:240494523-240494545 AAGCTGTCACTGCTGGGACAGGG - Intronic
948950138 2:241244570-241244592 AAGCTGTTTCTGCTGCATAAAGG - Intronic
1171342193 20:24438940-24438962 AAGTTGTTTCTGTTGGATCATGG - Intergenic
1174083276 20:47985814-47985836 GAACTGATATTGCTGGTTCATGG - Intergenic
1177536821 21:22439183-22439205 ACGCTGATACTGCTGGTTCATGG - Intergenic
1177968395 21:27758615-27758637 AAGCTAAAATTGCTGGTTCAAGG + Intergenic
1178136016 21:29628387-29628409 AAGCTGTTATTGCAAGATAATGG - Intronic
1179294761 21:40051787-40051809 GAGCTGTTATTGATGGATCTTGG - Intronic
949684820 3:6556768-6556790 GAGCTGTTTTTGCTGTCTCAGGG - Intergenic
951841828 3:27043165-27043187 AAGCTTCTATTGCTGTCTCATGG - Intergenic
952928920 3:38344756-38344778 AAGCTGTCATTGCTTATTCATGG - Intergenic
954197287 3:49004272-49004294 AAGCTGTTCTCACTGGAGCAGGG + Intronic
955588504 3:60508448-60508470 AAACTGTTATTACTGAATAATGG + Intronic
956435035 3:69226576-69226598 ATGTTGTTATTTCTGGATCCAGG + Intronic
956663490 3:71620988-71621010 AAACTGTAATTGCAGGATCTAGG - Intergenic
957015504 3:75059484-75059506 ATCCTGATACTGCTGGATCATGG - Intergenic
958038919 3:88202893-88202915 AAGTTGTCAGTGCTGGATGAAGG + Intergenic
959256952 3:104027551-104027573 AAGTTGTTCTTGCTGTCTCAGGG + Intergenic
965514121 3:169602435-169602457 AATCTGATATTGGTGGATAAAGG - Intronic
967242076 3:187449383-187449405 AAGCTGTTTTGGCTAGATCTTGG + Intergenic
971797580 4:31248476-31248498 AAACTGTTATAACTGGATAAAGG + Intergenic
972245397 4:37241789-37241811 AAGCTGTGATACCTGGATCCTGG + Intergenic
973886171 4:55324318-55324340 AAGATGTTATTGATAGATCATGG - Intergenic
980937572 4:139241073-139241095 AAGCTGGTATTGCTATCTCATGG - Intergenic
981718887 4:147779156-147779178 ATGCTGATGTTGCTGGTTCAGGG + Intronic
982658574 4:158178814-158178836 AAGCTGATGCTGCTGGTTCAGGG - Intergenic
991434834 5:66587210-66587232 AAGCTATTATTGTTGGGGCAGGG - Intergenic
992347211 5:75891923-75891945 AAGCTGTTTTTAATGGACCAGGG - Intergenic
995549077 5:113262845-113262867 ATGCTGATACTGCTGGTTCACGG + Intronic
996387718 5:122926272-122926294 AAGCTGGTGTGGCTGGACCAGGG + Intronic
997129820 5:131264802-131264824 CAGCTGTTAATGCGGCATCAAGG - Intronic
1001009623 5:168086057-168086079 AAGATGTTATTACTGGGTCCAGG - Intronic
1001716120 5:173817857-173817879 AAGCTGTTTTTCCTAGATCAGGG + Intergenic
1003370270 6:5518155-5518177 AGGCTGTTGTTGCTGCATCCAGG + Intronic
1003830150 6:10000544-10000566 ACGCTGATATTGCTGGCCCAGGG - Intronic
1004582594 6:16968617-16968639 ATGCTGATGTTGCTGGTTCAAGG + Intergenic
1005938475 6:30543110-30543132 AAGCTGGTCTTGGTGAATCAGGG - Exonic
1008081278 6:47196845-47196867 AAGCTGATGCTGCTGGTTCAGGG - Intergenic
1008874737 6:56313435-56313457 AAGCTGTAAGTGCAAGATCAGGG + Intronic
1009774394 6:68186921-68186943 AAGATGTGATTGATGGAGCAAGG + Intergenic
1010585435 6:77652659-77652681 AAGCTATGATTACTGGATAACGG - Intergenic
1011599369 6:89045587-89045609 AAGCCGTAATTGCTGGAGCTGGG - Intergenic
1015601082 6:134911328-134911350 ATGCTGTCATTGCAAGATCATGG - Intergenic
1020753641 7:12172752-12172774 AAGCTGTTGTTTCTGGGTAACGG + Intergenic
1023154854 7:37239128-37239150 AACCTGTTATTGTTGTATGAAGG + Intronic
1027707351 7:81550586-81550608 AAGCTTTTATTGCTATCTCATGG + Intergenic
1028199415 7:87943699-87943721 CCGCTGATATTTCTGGATCATGG - Intronic
1029891950 7:103939611-103939633 AAAGTGTAATTGCTAGATCAAGG - Intronic
1033723125 7:144083690-144083712 AAGCTGGTATTGCTATCTCATGG - Intergenic
1038902696 8:31861793-31861815 AAGATGACATTACTGGATCATGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041892677 8:62888613-62888635 TAGCTTTTATTGTTGGAGCATGG + Intronic
1043348639 8:79331186-79331208 AAGTTGTTATTGTTTGTTCATGG + Intergenic
1043425732 8:80146917-80146939 ATGCTGATACTGCTGGTTCAGGG - Intronic
1043992226 8:86769615-86769637 AAGCTGTTATTGCTGTGTTGAGG - Intergenic
1044862784 8:96539829-96539851 AAGGTGTCATTTCTGGAGCAAGG + Intronic
1045006452 8:97920524-97920546 AAGCTGTCATTTCTGGTTCTTGG + Intronic
1045278089 8:100724435-100724457 AAGAGGTGATTGATGGATCAAGG - Intergenic
1046722127 8:117632258-117632280 CGGCTGTTATTTCTGGATGAAGG + Intergenic
1046892052 8:119432889-119432911 ACTCTATTATTGATGGATCAAGG - Intergenic
1047645530 8:126866126-126866148 ATGCTGATGCTGCTGGATCAAGG + Intergenic
1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG + Intergenic
1049125584 8:140784388-140784410 AAGGTTTTACTGCTTGATCAAGG + Intronic
1053552988 9:39103687-39103709 AAGCTTTTATTGCTAAATAATGG + Intronic
1053817105 9:41923866-41923888 AAGCTTTTATTGCTAAATAATGG + Intronic
1054107359 9:61067516-61067538 AAGCTTTTATTGCTAAATAATGG + Intergenic
1054613498 9:67263609-67263631 AAGCTTTTATTGCTAAATAATGG - Intergenic
1057587703 9:96344637-96344659 AAGCTCTTTGTGCTGGATGAGGG - Intronic
1057897236 9:98919087-98919109 ATGCTGATACTGCCGGATCAGGG + Intergenic
1059638158 9:116190806-116190828 CAGCGGTTATAGCTGGCTCATGG - Intronic
1060173271 9:121478958-121478980 AAGTTGTTAATGCAGGAGCAGGG - Intergenic
1187305355 X:18090429-18090451 ATGCTGTTGCTGCTGGTTCAGGG + Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1188552088 X:31375539-31375561 TAGCTGTCATTGCTTGAACACGG - Intronic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1189921284 X:45905305-45905327 AAGCTTTTATTTTAGGATCAGGG + Intergenic
1189932481 X:46028766-46028788 AATCTGTTATTTCTGGCTCAGGG + Intergenic
1190375841 X:49787546-49787568 GAACTGTCATTGCTGCATCAAGG + Intergenic
1191729927 X:64322669-64322691 ATGCAGTTATTGCTGGCTCTTGG - Intronic
1193984846 X:88228096-88228118 AAGCTCTGATTGCTGGTTTAAGG + Intergenic
1196201041 X:112886275-112886297 ATGCTGTTTTTGCTGACTCAAGG - Intergenic
1197193148 X:123671122-123671144 ATGCTTTTATTGCTGGACCCAGG - Intronic
1199946448 X:152672376-152672398 GAGCTGGGATTGGTGGATCATGG - Intergenic
1201557464 Y:15278869-15278891 AACTTGGTATTTCTGGATCAGGG - Intergenic