ID: 1167204779

View in Genome Browser
Species Human (GRCh38)
Location 19:48093655-48093677
Sequence AATGAGAAGACCAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 1, 2: 6, 3: 46, 4: 407}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167204779_1167204785 14 Left 1167204779 19:48093655-48093677 CCAGCCTCACTGGTCTTCTCATT 0: 1
1: 1
2: 6
3: 46
4: 407
Right 1167204785 19:48093692-48093714 ACAAACTTGGTCCTGGCTTAGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1167204779_1167204784 13 Left 1167204779 19:48093655-48093677 CCAGCCTCACTGGTCTTCTCATT 0: 1
1: 1
2: 6
3: 46
4: 407
Right 1167204784 19:48093691-48093713 GACAAACTTGGTCCTGGCTTAGG 0: 1
1: 0
2: 3
3: 7
4: 126
1167204779_1167204782 1 Left 1167204779 19:48093655-48093677 CCAGCCTCACTGGTCTTCTCATT 0: 1
1: 1
2: 6
3: 46
4: 407
Right 1167204782 19:48093679-48093701 GTTCTAGAGTAAGACAAACTTGG 0: 1
1: 0
2: 2
3: 50
4: 268
1167204779_1167204783 7 Left 1167204779 19:48093655-48093677 CCAGCCTCACTGGTCTTCTCATT 0: 1
1: 1
2: 6
3: 46
4: 407
Right 1167204783 19:48093685-48093707 GAGTAAGACAAACTTGGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 117
1167204779_1167204786 24 Left 1167204779 19:48093655-48093677 CCAGCCTCACTGGTCTTCTCATT 0: 1
1: 1
2: 6
3: 46
4: 407
Right 1167204786 19:48093702-48093724 TCCTGGCTTAGGGTCTGATATGG 0: 1
1: 0
2: 2
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167204779 Original CRISPR AATGAGAAGACCAGTGAGGC TGG (reversed) Intronic
900487897 1:2932155-2932177 GATGAGAGGCCCAGTGTGGCCGG + Intergenic
901001952 1:6153302-6153324 AATGAGAAAACAAGGCAGGCTGG + Intronic
901449221 1:9325941-9325963 AGCCAGAAGACCAGTGGGGCAGG + Intronic
901947458 1:12715402-12715424 AATAAACAGACAAGTGAGGCAGG + Intergenic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902792322 1:18777755-18777777 AAGGAGAAGATCAGTGAGTGTGG + Intergenic
904280706 1:29416378-29416400 ACTTTGAAGACCAGTGAGCCTGG - Intergenic
904346860 1:29878446-29878468 CCAGAGAAGACCGGTGAGGCAGG + Intergenic
904521676 1:31100712-31100734 AATGAGTTGACCAGAGAGTCGGG - Intergenic
904576251 1:31506915-31506937 AATGAGAAGCAAAGGGAGGCAGG + Intergenic
905067670 1:35197116-35197138 AATGGGATGATCAGTGAGGCAGG - Intergenic
905167842 1:36093502-36093524 ACTGAGTACACCGGTGAGGCTGG + Exonic
905715851 1:40149258-40149280 AATGGCAAGACCAATGTGGCTGG + Intergenic
906937504 1:50226932-50226954 AATGAGGAGGCCAATGTGGCTGG + Intergenic
907058166 1:51391612-51391634 AGCAAGAAGACCAGTGTGGCTGG + Intronic
907347626 1:53795980-53796002 AATGTGGATACCAGTGTGGCTGG - Intronic
907582554 1:55584999-55585021 AATGAGGAGACAAGTCTGGCTGG - Intergenic
907959277 1:59263507-59263529 AAGGTGAAGACCAGAGATGCTGG + Intergenic
908666461 1:66496599-66496621 AATGTGAAGAGCAGTGAAGGTGG - Intergenic
908815580 1:68029621-68029643 AATGTGAGGACTAGTGATGCTGG + Intergenic
909962303 1:81861315-81861337 AATTAAAATATCAGTGAGGCTGG - Intronic
910241098 1:85086982-85087004 AATGAGGAAGCCAGTGTGGCTGG - Intronic
910548175 1:88443489-88443511 GATCAGAATAACAGTGAGGCAGG - Intergenic
911185899 1:94904794-94904816 AATGAGAAGACAAATGATACTGG - Intronic
911644960 1:100328125-100328147 AATGAGTAATCCAGTGTGGCTGG - Intergenic
912508065 1:110170182-110170204 AAATACAAAACCAGTGAGGCTGG + Intronic
913229712 1:116731607-116731629 AATGAGAATAACAGGGAGGTGGG - Intergenic
913414979 1:118595251-118595273 AATGAAGAGGCCAGTGTGGCAGG - Intergenic
914915955 1:151819397-151819419 GCTGAGAAGACCAGTGGGCCTGG + Intronic
915467291 1:156105058-156105080 AATGAGAAAACCACTGGGGGAGG - Intronic
915603172 1:156935243-156935265 GATGAGAAGTCCAGGGAGGGAGG + Exonic
916444575 1:164860465-164860487 TATAAGAAGACCAGTCTGGCTGG - Intronic
917603775 1:176604022-176604044 AGTCAGAAGGCCAGTGTGGCTGG - Intronic
918550802 1:185740034-185740056 AGTGAAAAGACCAGAGAGTCTGG + Intronic
919754017 1:201055259-201055281 AATGAGAAGACCAGTATGCCAGG - Intronic
919784283 1:201249343-201249365 AATAAAGAGACCAGTGGGGCTGG - Intergenic
920177769 1:204113808-204113830 GACGAGAAGAGGAGTGAGGCAGG + Intronic
920193423 1:204210366-204210388 AATGAGAAGAGAAGTGAGCTTGG - Intronic
920601702 1:207331877-207331899 ATTTAGAAGATCAGTGAAGCTGG + Intronic
920612695 1:207456867-207456889 AAAGAGAAGGCCAGTGTGGCTGG - Intronic
921050681 1:211509112-211509134 CAAGAAGAGACCAGTGAGGCTGG - Intergenic
921286803 1:213616391-213616413 GATGAGAAGACCACTGCGGTGGG + Intergenic
921326477 1:213989570-213989592 ACTGGGAAGACTAGTGAGGAGGG + Intronic
921678253 1:218001511-218001533 AAAGAGAAGGCCAGTGTGGCTGG - Intergenic
922055340 1:222037188-222037210 AGCGGGAAGACCAGTGAGGGAGG + Intergenic
922113091 1:222581811-222581833 AACAAGGAGACCAGTGAGGATGG + Intronic
922883106 1:228997509-228997531 AATACGAAGACCAGTTAGGAGGG - Intergenic
923606685 1:235450303-235450325 TGTGAGAAGACCTGTGAGACAGG - Exonic
923640494 1:235754519-235754541 ACTGAAAAGACAGGTGAGGCTGG - Intronic
924124957 1:240840567-240840589 ACAAAGAAGGCCAGTGAGGCCGG - Intronic
924256118 1:242184662-242184684 AGTCAGAAGACAACTGAGGCTGG - Intronic
924523366 1:244824611-244824633 TATAAGAAGAACACTGAGGCCGG - Intergenic
1064488261 10:15820291-15820313 AGTGAGAGGACCAGTGTGGCTGG + Intronic
1066357702 10:34701131-34701153 AATGAGCAGACCAGAGGGACAGG + Intronic
1067110044 10:43393966-43393988 AATGAGAAGACCTTTGAGAAAGG - Intronic
1070071960 10:73098572-73098594 AATTATAAGACCAAAGAGGCAGG + Intergenic
1070670817 10:78376203-78376225 AAGTAGCAGACCAGAGAGGCAGG - Intergenic
1070942927 10:80362539-80362561 AATGATAAAGCCAGTGAGCCAGG - Exonic
1071973491 10:90931531-90931553 AATGAGGAAACCAGTGAGTGTGG + Intergenic
1073095351 10:100976231-100976253 GCAGAGAAGACCAGTGTGGCTGG + Intronic
1073479180 10:103775443-103775465 AAGGACAAGATCAGTGTGGCTGG + Intronic
1074414513 10:113255546-113255568 ATTTAAAAGACCAGTTAGGCAGG - Intergenic
1074845512 10:117393962-117393984 TGAGAGAAGGCCAGTGAGGCTGG - Intergenic
1075186964 10:120271018-120271040 AATGAAAAGACCCATGAGGTTGG + Intergenic
1075667745 10:124243105-124243127 ACCCAGAAGAGCAGTGAGGCGGG + Intergenic
1076986844 11:243548-243570 AATAAGAAGACCACTGTGGAAGG - Intronic
1077606446 11:3615992-3616014 GAAGAGAAGAGCAGTGAGGATGG + Intergenic
1078162115 11:8849836-8849858 AAAGAAAAGACCAATAAGGCTGG + Intronic
1078341809 11:10502525-10502547 AATGAGATGAACAGTGGGGAAGG + Intronic
1078554270 11:12306577-12306599 CATGAGAAGACCATTTAGGATGG - Intronic
1079960169 11:26914045-26914067 TACAAGAACACCAGTGAGGCTGG - Intergenic
1080556376 11:33421156-33421178 AGTGAGAAGAGCAGTGAAGCAGG - Intergenic
1080745109 11:35101777-35101799 AAAGTGATGACCAGAGAGGCCGG - Intergenic
1080940723 11:36914608-36914630 AATAAGAAGTCCAGTTAGGTCGG - Intergenic
1081566251 11:44263077-44263099 GATGAGAACACCAGGCAGGCGGG + Exonic
1081748867 11:45493492-45493514 AGCAAGAAGGCCAGTGAGGCTGG - Intergenic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1083478882 11:62930769-62930791 AAAGAGAAGAACACAGAGGCAGG - Intergenic
1084160923 11:67349670-67349692 ACTGAGGAGGCCAGTGAGGCTGG - Intronic
1084927585 11:72525788-72525810 AATGAGGAAACTAGTGAGTCTGG + Intergenic
1086282799 11:85210310-85210332 AAGGAGAAGACAAGTGTGTCTGG - Intronic
1086814816 11:91356731-91356753 AACGAGGAGACCAGAGTGGCTGG - Intergenic
1087597066 11:100267640-100267662 CATTAGAGGATCAGTGAGGCAGG + Intronic
1087800519 11:102498419-102498441 GAGGAAGAGACCAGTGAGGCTGG + Intronic
1088634548 11:111807315-111807337 AAACAGGAGGCCAGTGAGGCTGG - Intronic
1088721523 11:112596345-112596367 ACTGAGAAGACCAGTGAATGAGG - Intergenic
1088889525 11:114033540-114033562 ACTCAGCAGACCAGTGAGGAAGG + Intergenic
1089413833 11:118270095-118270117 AACAAGGAGACCAGTGTGGCTGG + Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1090076764 11:123584603-123584625 AAAGAGGAGACCAGTCAGGGAGG + Intronic
1090382624 11:126337734-126337756 GATGAGAATCCCAGTGCGGCGGG + Intronic
1090831571 11:130424335-130424357 CATGAAAATACCAGTGAGGGGGG - Intronic
1092460719 12:8683681-8683703 AATGAGAAGACAAGCCAGACCGG - Intronic
1094415323 12:30209707-30209729 AACGGAAAGACCAGTGTGGCTGG + Intergenic
1095935075 12:47670721-47670743 GGTGAGAAGTCCAGTGGGGCTGG + Intronic
1096424633 12:51490744-51490766 AATGAGAAGGAAAGAGAGGCAGG + Intronic
1096882355 12:54683363-54683385 AATGAGAATAGCAGTGGTGCAGG - Intergenic
1096945343 12:55400965-55400987 AATGAGAAAACCAGCCAGCCAGG - Exonic
1097936058 12:65252732-65252754 AAATAGACGACCAGTGTGGCTGG - Intergenic
1098158580 12:67625190-67625212 AATGAGGAGACCAAAGAGACTGG - Intergenic
1100457460 12:94766330-94766352 ACTGTGTAGACCAGGGAGGCTGG + Intergenic
1100702594 12:97163996-97164018 GACAAGAAAACCAGTGAGGCTGG + Intergenic
1100708647 12:97229357-97229379 AATGAGATGAGCAATGAGGGGGG - Intergenic
1101974483 12:109344138-109344160 ATTGGGAAGACCACAGAGGCAGG + Intergenic
1102123156 12:110458897-110458919 ACTGAAAAGGCCAGTGTGGCTGG - Intronic
1102147525 12:110666120-110666142 AAAGAAAAGATCAATGAGGCTGG + Intronic
1102819332 12:115894660-115894682 AGTGAGAAGGCCAGTGTGGTTGG + Intergenic
1103088046 12:118077174-118077196 CGAGAGAAGACCAGTGTGGCCGG - Intronic
1103162795 12:118744088-118744110 CATGAGGAGGCCAGTGTGGCAGG + Intergenic
1105034846 12:132911266-132911288 CTTGAAAAGACTAGTGAGGCAGG - Intronic
1106774061 13:32991486-32991508 AGCGGGAAGACCAGTGAGGAGGG + Intergenic
1107767396 13:43751308-43751330 AACCAGAAGAGCAGTGATGCAGG - Intronic
1107850490 13:44567706-44567728 AATTAGAAGACCAGTCAAGAAGG + Intronic
1109996836 13:70138941-70138963 AATGAGAAAAACAGTAAGGCTGG - Intergenic
1110379662 13:74835881-74835903 AATGAGTACACCAGGTAGGCAGG - Intergenic
1110619130 13:77575983-77576005 AATGGGGAAACCAGTGAAGCAGG - Intronic
1111342304 13:86902653-86902675 AATGAGAGGGTCAGAGAGGCTGG - Intergenic
1112192771 13:97193925-97193947 AACTAAAAGACCAGGGAGGCTGG - Intergenic
1113011226 13:105768638-105768660 AATGAGAAGACAAGTTAGATTGG + Intergenic
1113288945 13:108884516-108884538 GATGAGAAAAGCACTGAGGCAGG + Intronic
1113648205 13:112013746-112013768 AAGCACAAGAGCAGTGAGGCTGG - Intergenic
1113748275 13:112761212-112761234 AAGCACAAGAGCAGTGAGGCAGG + Intronic
1114070802 14:19104677-19104699 AATGAGAGTGCTAGTGAGGCTGG - Intergenic
1114091459 14:19295329-19295351 AATGAGAGTGCTAGTGAGGCTGG + Intergenic
1114482844 14:23046175-23046197 AGGGAGAGGACCAGGGAGGCAGG - Intergenic
1114572623 14:23684211-23684233 AGCGAGAAGGCCAGTGTGGCTGG + Intergenic
1114846889 14:26333204-26333226 AGTGAGAAGGCCAGGGTGGCTGG - Intergenic
1116289091 14:43008580-43008602 AAGGAAGAAACCAGTGAGGCAGG + Intergenic
1116763961 14:49048466-49048488 GATGTGAAGACCAGTGAAGGTGG + Intergenic
1116959551 14:50955910-50955932 ACTGTGATGACCAGTGGGGCAGG + Intergenic
1117116343 14:52517152-52517174 AAAGAGAAGACCAGAGCGGGAGG - Intronic
1117473192 14:56067462-56067484 AATGAGAAGGCAAGGGTGGCAGG + Intergenic
1118242578 14:64074300-64074322 AGGGAGAAGATCAGTGTGGCTGG + Intronic
1118911285 14:70064094-70064116 CAGGAGGAGCCCAGTGAGGCTGG - Intronic
1119578439 14:75751382-75751404 AAAGATAAGAGTAGTGAGGCTGG - Intronic
1120598553 14:86472053-86472075 ATTGTAAAGACCATTGAGGCTGG - Intergenic
1120667952 14:87329522-87329544 AATTTGAAGACCAGAGAGGCTGG - Intergenic
1120761387 14:88288726-88288748 AATGAGAAGACCAGTGTGGCTGG - Intronic
1121171789 14:91860658-91860680 AGTAAGAAGACCAGTGTGGTTGG - Intronic
1121867501 14:97376714-97376736 ACTGAAAAGTCCAGTGAGGCTGG - Intergenic
1125033531 15:35096935-35096957 TATGAAAAAAACAGTGAGGCTGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1126041057 15:44591674-44591696 ACAGTGAAGACCAGTGTGGCCGG + Intronic
1127041659 15:54983850-54983872 AAACTGAAGGCCAGTGAGGCTGG - Intergenic
1127308286 15:57729088-57729110 GATGAGATGCCCAGGGAGGCCGG + Intronic
1127528505 15:59818027-59818049 AATGGGAAGGGCAATGAGGCAGG + Intergenic
1128062960 15:64746867-64746889 GGTGAGAAGCCCAGTGAGGTGGG + Intronic
1128459136 15:67852927-67852949 AGTGGGAAGAACAGGGAGGCGGG - Intergenic
1128748985 15:70135027-70135049 ACTGAGCAGTTCAGTGAGGCTGG - Intergenic
1129172326 15:73815826-73815848 GATAAAAAGGCCAGTGAGGCTGG - Intergenic
1129662112 15:77558802-77558824 AATGACAAGAGGAGGGAGGCAGG - Intergenic
1130140897 15:81225478-81225500 AATGCTAAGACCAGTGATGATGG + Exonic
1130941863 15:88516977-88516999 AATGAAAGGACCGGTGAGGAAGG + Intronic
1131095900 15:89654362-89654384 AGTGAGTAGTCCAGGGAGGCAGG - Intronic
1131491246 15:92865060-92865082 AATGAAAGGATCACTGAGGCCGG - Intergenic
1131872410 15:96776139-96776161 AATGAGAACACCAGCAAGGAAGG - Intergenic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1132929291 16:2450751-2450773 AATGTGGAAACCAGTGAGGGTGG - Intronic
1133939093 16:10293621-10293643 AATGAGAGGTCCTATGAGGCGGG - Intergenic
1134381965 16:13735908-13735930 AATGAAAACAACAGTGAGACTGG - Intergenic
1134467573 16:14492874-14492896 AAAGAGAAGTCCAGGGAGGCAGG - Intronic
1134472981 16:14544276-14544298 AAGGAAAAGACCAGTTTGGCTGG + Intronic
1135086406 16:19478113-19478135 AATGAGAAGGCCAGGGAGGCTGG - Intronic
1135243852 16:20837061-20837083 AATGAGAAGACAAGCCAGACTGG - Intronic
1137780640 16:51095241-51095263 ACTCTGAAAACCAGTGAGGCAGG + Intergenic
1139572461 16:67821691-67821713 CATGAAAATGCCAGTGAGGCCGG + Intronic
1140014761 16:71171117-71171139 TACGAGAAGGCCAGTGGGGCTGG - Intronic
1140261266 16:73382576-73382598 AATCAGGAAACCAGGGAGGCTGG + Intergenic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140880741 16:79195883-79195905 AATAAGAAAAACAGTGACGCAGG - Intronic
1141489614 16:84363301-84363323 ACTAAGAAGAAAAGTGAGGCTGG - Intergenic
1142703337 17:1678016-1678038 AAAGTTAAGTCCAGTGAGGCTGG + Intronic
1143511211 17:7396127-7396149 AGGCAGAAGACCAGTGAGACTGG + Intronic
1143527972 17:7483315-7483337 AAAGAGAAGAGCATTGGGGCTGG + Exonic
1143634478 17:8156485-8156507 AATGAGAAGACGATGGCGGCCGG - Intronic
1144401933 17:14913012-14913034 AAAGAGAAGGCTAGTGAGGGAGG + Intergenic
1145275174 17:21424849-21424871 AAAGGGAAGGCCAGTGGGGCTGG + Intergenic
1145313028 17:21710747-21710769 AAAGGGAAGGCCAGTGGGGCTGG + Intergenic
1145711451 17:26982552-26982574 AAAGGGAAGGCCAGTGGGGCTGG + Intergenic
1146197020 17:30822149-30822171 CATGAGAAGAGCAGAGAGGAAGG - Intronic
1146556449 17:33828817-33828839 AATGAGAAGATGAGTAAGACTGG - Intronic
1146713222 17:35061039-35061061 CATGAGAAGTTCAGTGAAGCTGG + Intronic
1146730789 17:35192955-35192977 AAAGAGAAGAGCATTGGGGCTGG - Exonic
1146780658 17:35668682-35668704 AATGAAAAGGCCAGTTAGACTGG - Intronic
1147006036 17:37405020-37405042 AAGGGCAAGACCAGTGTGGCTGG - Intronic
1149490496 17:57081637-57081659 AATGAGAAGAGAGGTGAGGGTGG - Intergenic
1151647180 17:75441259-75441281 AGAGAGAAGGCCAGTGTGGCTGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152969399 18:147336-147358 AATGAACAGTGCAGTGAGGCCGG + Intergenic
1154297383 18:13162646-13162668 AATAAGAAGACAATCGAGGCAGG + Intergenic
1155636035 18:27956589-27956611 CAGGCGAAGACCAGTTAGGCAGG - Intronic
1156935555 18:42701960-42701982 AATGAGAGATCCAGTGTGGCTGG + Intergenic
1157631883 18:49106494-49106516 ATTGTAAAGACCATTGAGGCTGG - Intronic
1157899189 18:51497588-51497610 AATGAGAAGACAAGTCTGACTGG + Intergenic
1158159343 18:54462398-54462420 AAGAAGAAGGCCAGTGTGGCTGG - Intergenic
1158176955 18:54668268-54668290 ATTGTAAAGACCATTGAGGCTGG - Intergenic
1158446381 18:57525990-57526012 TATAAGAAGACCAGTGTGGCTGG + Intergenic
1158783902 18:60685513-60685535 CATGAGAAGACAAGGGAGGTCGG + Intergenic
1159430624 18:68348133-68348155 AAGTACAAGACCAGTGATGCTGG + Intergenic
1161289394 19:3484982-3485004 AGTGAGGAGGCCAGTGTGGCTGG + Intergenic
1161422024 19:4181187-4181209 AAGGAGGAGACCTGTGTGGCTGG - Intronic
1161761701 19:6178132-6178154 AATGAGAAGACGGGAGAGGAAGG - Intronic
1162096029 19:8310495-8310517 ATTGTGAAGACCAGTCAGGTGGG - Intronic
1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG + Exonic
1163083136 19:14957930-14957952 AGAGAGAAGACCAATGTGGCTGG + Intronic
1163297525 19:16421868-16421890 AGTGGGAGGACCAGGGAGGCTGG - Intronic
1163490255 19:17613574-17613596 AATGAGGTGACCTGTGGGGCTGG - Intronic
1163794058 19:19325914-19325936 AATGTGATGACCAAGGAGGCTGG - Intronic
1164698126 19:30262219-30262241 AATGAGGAGACCAGCCAGGCAGG - Intronic
1165130382 19:33628381-33628403 AGTAGGAAGACCAGCGAGGCTGG + Intronic
1166053294 19:40273942-40273964 AGCGAGCAGACCAGTGAGGCTGG - Intronic
1166885828 19:45960578-45960600 ACAGAGAAAACCAGTGAGACTGG + Intronic
1167198010 19:48044034-48044056 AAGGAGAAGCCAAGAGAGGCAGG - Exonic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
925057974 2:870049-870071 GATCAGAAGAGCAGTGAGGCTGG - Intergenic
926140338 2:10364430-10364452 AATGCGATGGCCAGGGAGGCAGG + Intronic
926751589 2:16202644-16202666 AATCTGAAGCCCAGAGAGGCAGG - Intergenic
927879284 2:26679411-26679433 GATGGGAAGAGGAGTGAGGCTGG + Intergenic
928202450 2:29257016-29257038 AGTGAGACTAGCAGTGAGGCTGG + Intronic
931621228 2:64211694-64211716 AGTCAGGAGACCAGTGTGGCTGG - Intergenic
931669338 2:64632712-64632734 AATGAGAAGACCTGGGGGCCTGG + Exonic
932365049 2:71145768-71145790 AATCAGAAGATCAGTGGGGGTGG - Intronic
933203228 2:79475365-79475387 AAAGGGAAGACAAGTGAAGCTGG + Intronic
934809869 2:97269281-97269303 CATGAGAACACCAGTGGGGTTGG - Intergenic
934827828 2:97438704-97438726 CATGAGAACACCAGTGGGGTTGG + Intergenic
935695717 2:105769080-105769102 AATGAGGTGACCAGTGGGGTTGG - Intronic
936007137 2:108899687-108899709 AATAATAACACCAGTAAGGCTGG + Intronic
936891415 2:117374121-117374143 AATGATAAGACCCCTGAGGATGG + Intergenic
937119095 2:119429932-119429954 AATCAGAAGAACAGTCAGGTCGG - Intronic
938549769 2:132369257-132369279 AACCAGAAGACAAGTGAGCCGGG + Intergenic
938628231 2:133135337-133135359 GAAGAGAAGCCCAGTGTGGCTGG + Intronic
938949807 2:136245627-136245649 AATGAGAACGCCAGGGAGGCTGG + Intergenic
939119157 2:138095429-138095451 AATAAGAAAGCCAGTGAGACTGG - Intergenic
940743031 2:157533966-157533988 AATACGAAGAGCAGTTAGGCGGG + Exonic
941221086 2:162782500-162782522 AATGAGAAGGCCAGTGTGGCTGG + Intronic
942044548 2:172092296-172092318 AAAGCCAAGACCAGTGAGGAGGG - Intergenic
942790516 2:179756021-179756043 ATTGTAAAGACCACTGAGGCTGG - Intronic
943379982 2:187132864-187132886 AATGAGAAGTCCAGTATTGCTGG + Intergenic
943715930 2:191151780-191151802 AATGAAAAGACCACTGAAGTGGG - Intergenic
945824964 2:214710488-214710510 AATAAGAAGACAACTGAAGCAGG + Intergenic
946863054 2:224018347-224018369 AATGTGTTGACCACTGAGGCAGG - Intronic
1169000586 20:2165048-2165070 GATGAGAAAACCAGTGCTGCTGG + Intronic
1170201054 20:13744596-13744618 AATAAGGAGGCCAGTGTGGCTGG - Intronic
1170441661 20:16385675-16385697 GATGAGAAGAGCAGTGGGGAAGG + Intronic
1170960044 20:21017511-21017533 GATGAGAAAACCAGGGATGCTGG + Intergenic
1172788730 20:37487682-37487704 AAGGGGAAGACAAGTGAGGGTGG - Intergenic
1172832045 20:37844234-37844256 AAAGAGAAGACCTGGGAGTCAGG + Intronic
1172867552 20:38111871-38111893 AATGAGAAAATCAGTTTGGCTGG + Intronic
1172991932 20:39042989-39043011 AATGAGCAGGCTAGGGAGGCTGG + Intergenic
1173475065 20:43353118-43353140 AATGAGGAGACCAGGCAGGCGGG + Intergenic
1174012974 20:47465505-47465527 AACAAGAAGACCAGGGAGGCCGG - Intergenic
1174021872 20:47536786-47536808 AAAGAAAAAAACAGTGAGGCTGG - Intronic
1174306023 20:49614906-49614928 AGTGAGGAGGCCAGAGAGGCTGG + Intergenic
1174411613 20:50340263-50340285 AAAGAGGAGCCCAGTGTGGCAGG - Intergenic
1174607364 20:51770489-51770511 CAAGAGAAGACCAAGGAGGCCGG + Intergenic
1175014780 20:55777835-55777857 AAATAGAACACCAGTGTGGCAGG + Intergenic
1175187690 20:57190067-57190089 AGTGAAGAGGCCAGTGAGGCTGG + Intronic
1175366334 20:58458832-58458854 AGAGAGAAGGCCAGTGTGGCCGG + Intergenic
1175394932 20:58651315-58651337 AGTGAGAAGGCCGGGGAGGCAGG + Exonic
1175973859 20:62700473-62700495 GATGAGGAGACGCGTGAGGCAGG - Intergenic
1176366586 21:6036748-6036770 AATCAGAAGAGCAGTGATGCTGG - Intergenic
1178606870 21:34045253-34045275 AATAGGAAGGCCAGTGTGGCTGG - Intergenic
1178662006 21:34514800-34514822 AATCAGGAGGCCAGAGAGGCAGG + Intronic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1179714283 21:43279834-43279856 AAGGGGCAGGCCAGTGAGGCTGG + Intergenic
1179756931 21:43501797-43501819 AATCAGAAGAGCAGTGATGCTGG + Intergenic
1180489266 22:15827142-15827164 AATGAGAGTGCTAGTGAGGCTGG - Intergenic
1180910534 22:19447165-19447187 AAGGAGGAGACCAGCGAGGAGGG - Intronic
1181392376 22:22593143-22593165 AAGGAGAACACCAGTCAGACTGG - Intergenic
1181457511 22:23068122-23068144 CCAGAGAAGACCAGTGTGGCTGG - Intronic
1182192511 22:28477442-28477464 ATTGAGAAGGCCAATGTGGCTGG - Intronic
1182966204 22:34523495-34523517 AAGAAGAAGGCCAGTGTGGCTGG - Intergenic
1183468077 22:37990138-37990160 GAGGAAAAGACCAGGGAGGCTGG + Intronic
1184724431 22:46335463-46335485 CAGAAGAAGAGCAGTGAGGCCGG + Exonic
950699342 3:14729404-14729426 AGTAAGAAGGCTAGTGAGGCTGG + Intronic
951754466 3:26074813-26074835 GATGCAAAGACCAGTGTGGCTGG - Intergenic
952013441 3:28929516-28929538 AATGTGAAGTCCAGGAAGGCAGG - Intergenic
953501209 3:43436464-43436486 AAGGAGAAGAACAGTGAAGGTGG + Intronic
953965394 3:47300934-47300956 AATTAGAATCCCAGTGAGGCCGG - Intronic
954917703 3:54163058-54163080 GGTCAGAAGACCAGTGTGGCTGG + Intronic
955712764 3:61797509-61797531 TGTGAGAAGAACAGGGAGGCTGG + Intronic
956711151 3:72039855-72039877 AATGGGGAGCACAGTGAGGCTGG - Intergenic
957923306 3:86775376-86775398 AATGAAAAGACCAATCAGGTAGG - Intergenic
958706290 3:97660502-97660524 AAAGAGAGGATAAGTGAGGCGGG + Intronic
958914872 3:100038250-100038272 AATGAGAAGAAAAGAGAGGCCGG - Intronic
960521773 3:118663209-118663231 AATGAGAATACCAATGAATCAGG + Intergenic
961742083 3:129039388-129039410 CCTGTGAAGACCCGTGAGGCAGG - Intronic
962081657 3:132145690-132145712 AATTAGAAGTCCAGTGCAGCTGG + Intronic
962257845 3:133884602-133884624 GAAGAGAAGTCCAGTGAGACAGG + Intronic
962525184 3:136231876-136231898 AGACAGAAGACCAGTGTGGCTGG + Intergenic
963670384 3:148244357-148244379 AATGAGAAGGGCAGTAAGACAGG + Intergenic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
964260548 3:154830709-154830731 TGTAAGAATACCAGTGAGGCTGG + Intergenic
964914688 3:161826281-161826303 AATGATAATACCAGTGTGCCTGG + Intergenic
965020854 3:163229183-163229205 AATGCTAAGACCAGTGTGGCTGG + Intergenic
965414012 3:168369625-168369647 TAAGAGAAGAGCAGTGAGGCTGG - Intergenic
966342489 3:178940952-178940974 AATGTAAAGACCATTGAGACAGG - Intergenic
966832933 3:184026331-184026353 ATTAAGAAGACCAGGGAGGCAGG + Intergenic
966886911 3:184381905-184381927 AATGAGAGGTCGGGTGAGGCCGG - Intronic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
968780110 4:2573954-2573976 AACAAGGAGACCTGTGAGGCTGG + Intronic
969914931 4:10481457-10481479 AAAGATAAGAGCACTGAGGCAGG + Intergenic
970022990 4:11590025-11590047 AATATCAAGGCCAGTGAGGCTGG - Intergenic
970275274 4:14393043-14393065 AATGAGAAGATCCATGAAGCAGG - Intergenic
970852490 4:20617656-20617678 AATGAGGTGCCCAGTGGGGCTGG - Intronic
971705397 4:30035509-30035531 AATGATAAGACCCGTGATGAAGG - Intergenic
972079373 4:35131083-35131105 GATAAAAACACCAGTGAGGCTGG - Intergenic
972636244 4:40886576-40886598 AATAAGAAGAACGCTGAGGCCGG + Intronic
973310392 4:48703496-48703518 AATGAAAAGACCAGTTTAGCTGG - Intronic
974335328 4:60536367-60536389 AATGAGTAGACCAGTATAGCTGG - Intergenic
975579872 4:75896684-75896706 GATGAGAAGACAAGAGAGGTTGG - Intronic
976110389 4:81667198-81667220 AATGAGAAGGCCAGAGAGGCTGG - Intronic
976110454 4:81667809-81667831 AATGAAAGGACCAGTGAGGGTGG + Intronic
976674129 4:87685643-87685665 ATGGAGGAGGCCAGTGAGGCTGG - Intergenic
976951950 4:90844445-90844467 AATAAGAAGGCCAATGTGGCTGG - Intronic
978251988 4:106641779-106641801 AATGAGAAAAACAGAGAGGAGGG - Intergenic
979877363 4:125910245-125910267 AATGAGAACAGCAGTGCTGCAGG + Intergenic
980034742 4:127870994-127871016 AGTCAGAAGGCCAGTGTGGCTGG + Intergenic
981585961 4:146302667-146302689 ACTGAGAAAACCAGAGAGGCTGG + Intronic
981609131 4:146573753-146573775 GATGACAAGATCAGTGAGCCAGG - Intergenic
982691926 4:158558216-158558238 AATGAGGACACCAATGAGGAAGG - Intronic
982972383 4:162005509-162005531 AATGGGAAAACCAGTGAGACGGG + Intronic
983237318 4:165194173-165194195 AACAAGAAGACCAATGTGGCTGG - Intronic
983965697 4:173807422-173807444 TATGAGATGACCAGTATGGCAGG + Intergenic
984593376 4:181640682-181640704 AATGAGATGACCACAGAGTCTGG - Intergenic
985100121 4:186450548-186450570 ACTGAGAAGAGCAGAGCGGCTGG - Intronic
985312370 4:188616378-188616400 AACAAGGAGACCAGTGAGGCTGG - Intergenic
986619377 5:9655838-9655860 AAAGAGAAAACCACAGAGGCAGG - Intronic
987269783 5:16294773-16294795 AATGAGAAACCCAGTGACACTGG - Intergenic
988184146 5:27837688-27837710 AATGAGGATATCAGTGAGGCTGG + Intergenic
988910204 5:35832469-35832491 AATGAGAAGACCAGACAGCTGGG - Intergenic
988946908 5:36212830-36212852 ATTGTGAATACCAGGGAGGCAGG - Intronic
988987460 5:36634681-36634703 GAGGAGAGGACCAGAGAGGCAGG - Intronic
991375225 5:65958462-65958484 AATACGAAAACCAGTCAGGCGGG + Intronic
991442903 5:66669765-66669787 AGTGAGAAGTACAGTGAGGGTGG + Intronic
992190088 5:74283554-74283576 AATCAGAAGACCTGTGATCCAGG - Intergenic
992377973 5:76208385-76208407 CATGGGAAGACCACTTAGGCTGG - Intronic
992987041 5:82241548-82241570 AATGACAAGACCAGTGTGGTTGG - Intronic
994077557 5:95670353-95670375 GCTGAGAATACCAGTGAGGCAGG - Intronic
994314141 5:98312854-98312876 AGTGAGGAGACCAGGGTGGCTGG + Intergenic
995569491 5:113464335-113464357 AATAAGCAGGCCAGTGTGGCTGG - Intronic
995667430 5:114558629-114558651 AATGAAAAGACAAGAGAGGGTGG + Intergenic
996687526 5:126300078-126300100 AATTAGAAAACCCGTGAAGCTGG - Intergenic
997206826 5:132055053-132055075 AAAGAAAAGATCAGTAAGGCTGG + Intergenic
997852604 5:137346209-137346231 AATGAGAAGCCCAGGAAGACCGG + Intronic
997861484 5:137421886-137421908 ATTGTAAAGACCATTGAGGCTGG - Intronic
997899754 5:137754002-137754024 AATGTGCAGACGAGTGAGTCGGG - Exonic
998021032 5:138770514-138770536 AAAGAGAAGGCCAGTGTAGCTGG - Intronic
998325271 5:141274656-141274678 ATTAAGAAATCCAGTGAGGCCGG + Intergenic
998362079 5:141597061-141597083 AATTAGAAGACCAGTTTGGGAGG + Intronic
998760703 5:145428907-145428929 AATAAGGAGGCCAGTGTGGCTGG + Intergenic
999094524 5:148966135-148966157 AAGCAGAAGACTAGTGAGGCAGG - Intronic
1000202875 5:159028890-159028912 CAGAAGAAGGCCAGTGAGGCTGG + Intronic
1000326665 5:160177538-160177560 AATGGACAGACCAGTGTGGCTGG - Intergenic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1001367895 5:171162555-171162577 AATGTGAAAACCAGCAAGGCTGG - Intronic
1002164833 5:177337701-177337723 AATGATGAGACCACTGAGGTAGG - Exonic
1003011224 6:2429098-2429120 AAGGAAAAGACCAGTGAAGTGGG + Intergenic
1003916568 6:10792212-10792234 AATGAGAAGGACACTAAGGCTGG + Intronic
1003995276 6:11534547-11534569 AATGAGAAGACCTGTGGAGCTGG + Intergenic
1006081190 6:31567838-31567860 AAACAGAAGGCCAGTGTGGCTGG - Intergenic
1006251467 6:32790624-32790646 AATAAGAAGGCCAGTGAGGCTGG + Intergenic
1007712228 6:43831758-43831780 AAGGAGTAGAGAAGTGAGGCAGG + Intergenic
1008468704 6:51859189-51859211 CATGAGAAGATAGGTGAGGCAGG - Intronic
1009864962 6:69386039-69386061 AATGAGAACACCAGTTGAGCTGG + Intronic
1010502365 6:76616217-76616239 AAGGAGGAGGCCAGTGTGGCTGG - Intergenic
1012409112 6:98935823-98935845 AATGAGAAGAACTGTGACTCTGG + Intronic
1013033220 6:106356422-106356444 AATCAGAAGCTCAGTGATGCTGG - Intergenic
1013311745 6:108900971-108900993 AGTGAGAAGAACAATGAGTCTGG + Intronic
1014628597 6:123761048-123761070 AATAAGAAGGCCAGTGGGGCTGG + Intergenic
1014916020 6:127149410-127149432 TATGAGAAGGGAAGTGAGGCTGG - Intronic
1015619717 6:135118431-135118453 AGAGAGAAGAGGAGTGAGGCAGG - Intergenic
1017465025 6:154686830-154686852 AATACGAAAACCAGTCAGGCGGG - Intergenic
1018734323 6:166676017-166676039 AATGAAAAGTCCTGGGAGGCCGG + Intronic
1020752518 7:12160527-12160549 AATGAGAAAACCAGTGAATGTGG - Intergenic
1021620990 7:22550770-22550792 GATGTGAAGAACAGTGAGGTAGG - Intronic
1022246030 7:28560298-28560320 AATGAATAGACCAGTGTGGCTGG + Intronic
1022685389 7:32591505-32591527 ACTGTGAAGGCCAGTGAGGAAGG - Intergenic
1023605505 7:41927429-41927451 AATGACAAAACCAGATAGGCTGG - Intergenic
1023787220 7:43719830-43719852 AAAGAGAACACCAGAGAAGCTGG + Intronic
1024277812 7:47693105-47693127 AATGAGAATAGCTGGGAGGCAGG - Intergenic
1024683411 7:51718028-51718050 AGAGAAAAGACCAGTGTGGCAGG - Intergenic
1025986781 7:66460267-66460289 AATGATAGGAGCAGAGAGGCTGG - Intergenic
1025999929 7:66552687-66552709 AAAGAGAAGACCCTGGAGGCAGG - Intergenic
1026993104 7:74598871-74598893 AAAGAGAAGACCCTGGAGGCAGG - Intronic
1027210052 7:76139107-76139129 AATGATAGGAGCAGAGAGGCTGG - Intergenic
1027604044 7:80277418-80277440 ACTAAGGAGACTAGTGAGGCTGG + Intergenic
1027703089 7:81493546-81493568 CATGAGAAGACCAGAGAGATGGG + Intergenic
1027943456 7:84715104-84715126 AATGTGAACACCTGTGAGGCTGG - Intergenic
1027962611 7:84965791-84965813 AAAGAGAATACCAGGGAAGCAGG + Intergenic
1028516454 7:91682549-91682571 AATAAGAAGACTAGTGAGTGGGG + Intergenic
1029581519 7:101439597-101439619 TGTGAGAAGACCAGTGTGGCTGG + Intronic
1030163234 7:106529332-106529354 AATGAGAAGTTCTGAGAGGCGGG + Intergenic
1030447622 7:109667223-109667245 AAGGAGAGGTCCACTGAGGCTGG + Intergenic
1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG + Intronic
1033205241 7:139414662-139414684 AAGGAAAAGACCAGTGTGGCTGG - Intronic
1033298715 7:140165751-140165773 AAGCACAAGAGCAGTGAGGCTGG + Intronic
1033516631 7:142113135-142113157 GTTGAGAAGAGCAGGGAGGCAGG + Intronic
1034037098 7:147836360-147836382 AAAGAGAAGACCAGTGTGGCTGG - Intronic
1034494484 7:151411380-151411402 AATGTGAGGACCATGGAGGCTGG + Intergenic
1035067907 7:156121552-156121574 GATGACAAAACCAGCGAGGCGGG + Intergenic
1035669725 8:1408220-1408242 AATGAGTTGGACAGTGAGGCAGG - Intergenic
1037731590 8:21529641-21529663 AATGAGAAAACAATTGAAGCTGG - Intergenic
1037739261 8:21592337-21592359 CATGAGGAGACCAGGGTGGCAGG + Intergenic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1038499442 8:28031205-28031227 AGTGAGGAGAGCAGTGAGGTTGG - Intronic
1038598312 8:28911237-28911259 AATGAGAAGACCTGGGGGGAGGG + Intronic
1040333295 8:46403324-46403346 ATTTAGAAGAACAGTGAGACAGG + Intergenic
1040917496 8:52578301-52578323 ATTGAGAAGACCAGTGTAGCTGG - Intergenic
1041043348 8:53868454-53868476 AAACTGCAGACCAGTGAGGCCGG - Intronic
1041354387 8:56984906-56984928 CATGAGAAGACTAGTAAGTCTGG - Intronic
1042495360 8:69449750-69449772 ATTGAGAAGGCTGGTGAGGCTGG - Intergenic
1043582263 8:81727732-81727754 AGTGAGGACACCAGTGTGGCTGG + Intronic
1044230625 8:89773430-89773452 AGTGAGAAGGCCTGTGTGGCTGG + Intronic
1045396744 8:101768397-101768419 AATGAGAAAACCAGTCAGAAAGG + Intronic
1045555793 8:103213452-103213474 AAAGAGAAGACCAGAGTGGTTGG + Intronic
1046530517 8:115439095-115439117 AGTGAGAAGTGCAGTGGGGCTGG + Intronic
1046635354 8:116669425-116669447 ACTGAGAAGAGCAGTGGGGATGG + Intronic
1047216792 8:122882606-122882628 AGTGAGCAGACCACTCAGGCGGG - Intronic
1047436903 8:124842475-124842497 AATGAAAAAACCAGGGACGCGGG - Intergenic
1047548929 8:125848604-125848626 CAGAAGAAGACCAGTGTGGCTGG - Intergenic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1049122611 8:140752882-140752904 CATGAGCAAGCCAGTGAGGCTGG + Intronic
1049953935 9:673981-674003 ACTGGGAAGACCAGAGAGGGAGG - Intronic
1051083532 9:13320815-13320837 AATGAGTAGACCAGTCTGGAGGG + Intergenic
1051356943 9:16248028-16248050 CAAGAGAACACCAGAGAGGCTGG - Intronic
1051938956 9:22481185-22481207 AATAATAAGACCAGTAAGGAGGG - Intergenic
1053278773 9:36802960-36802982 AATGAGGAACCCAGTGAGACTGG + Intergenic
1053410175 9:37911168-37911190 CAGGAGATGTCCAGTGAGGCTGG + Intronic
1055250701 9:74301738-74301760 AAGAATTAGACCAGTGAGGCTGG + Intergenic
1055768216 9:79688080-79688102 AATGTGAAGACCAGCAAGGTGGG - Intronic
1056345847 9:85693993-85694015 AATGAGGTGGCCAGTGTGGCTGG + Intronic
1056792501 9:89635111-89635133 AATGGGAAAAACAGTGGGGCAGG - Intergenic
1057014222 9:91636408-91636430 AATCAAAAGACCAGGGTGGCTGG + Intronic
1058659130 9:107252890-107252912 AATGAGAAGACAAGAGAGAAGGG + Intergenic
1059963723 9:119592814-119592836 AATGAAAAGACCAGTGCAGCTGG + Intergenic
1060646799 9:125287529-125287551 AATGGGAAGGCCAGTTTGGCAGG + Intronic
1061406164 9:130394072-130394094 AATGGGAAGGACAGTGAGGGAGG + Intronic
1061656783 9:132098017-132098039 AGTGAGGAGACCAGAGTGGCTGG + Intergenic
1061891167 9:133620958-133620980 ATCGACAAGAGCAGTGAGGCTGG - Intergenic
1061926081 9:133806698-133806720 AATGAGACGGCCAGGGAGGCAGG + Intronic
1062155902 9:135048430-135048452 AATGAGGGGAGGAGTGAGGCGGG - Intergenic
1062507857 9:136887042-136887064 TCGGGGAAGACCAGTGAGGCTGG + Intronic
1186124836 X:6401969-6401991 TTTTAGAAGACCAGTGAGTCAGG + Intergenic
1187041712 X:15603457-15603479 AATTAGAAGACCAAAGATGCAGG + Intergenic
1187106302 X:16245938-16245960 AGAGAGAAGGCCAGTGTGGCTGG + Intergenic
1188607658 X:32052498-32052520 AATGAGAAGACCGGTAAAGTGGG - Intronic
1189562885 X:42209048-42209070 AGTGACAGGAGCAGTGAGGCTGG + Intergenic
1189863179 X:45294361-45294383 AGGAAGAAGGCCAGTGAGGCTGG - Intergenic
1190411763 X:50143579-50143601 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1192543658 X:71995499-71995521 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1193083890 X:77431011-77431033 GAAGAGAAGAGAAGTGAGGCAGG - Intergenic
1194438323 X:93896980-93897002 AATGAGAGGTCCAGTGTGGTGGG + Intergenic
1194589531 X:95781814-95781836 AATCAGAAGAGTAGTGATGCTGG + Intergenic
1197869749 X:131053734-131053756 AAATAGAAAACCAGGGAGGCAGG + Intergenic
1198393096 X:136196169-136196191 AGTGAGGAGGCCAGTGAGGTGGG + Intronic
1198838843 X:140834715-140834737 AAAGAGAAAGCCAGTGCGGCTGG - Intergenic
1198861084 X:141071203-141071225 CATGAGAAGAGCAGAGAGTCAGG + Intergenic
1198901608 X:141516180-141516202 CATGAGAAGAGCAGAGAGTCAGG - Intergenic
1199850429 X:151721969-151721991 CATGAGAAGACAGGTGAGGAGGG + Exonic
1199941306 X:152630526-152630548 AATAAGGAGGCCAGTGAGGCTGG - Intergenic