ID: 1167208099

View in Genome Browser
Species Human (GRCh38)
Location 19:48116002-48116024
Sequence GAGACTGAGCAGGGGGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167208099_1167208110 19 Left 1167208099 19:48116002-48116024 CCAGCGACCCCCTGCTCAGTCTC 0: 1
1: 0
2: 0
3: 13
4: 239
Right 1167208110 19:48116044-48116066 CTGTTTCCTGATCCACATGACGG 0: 1
1: 0
2: 2
3: 40
4: 340
1167208099_1167208104 -5 Left 1167208099 19:48116002-48116024 CCAGCGACCCCCTGCTCAGTCTC 0: 1
1: 0
2: 0
3: 13
4: 239
Right 1167208104 19:48116020-48116042 GTCTCCTCCCTCCTCCACTCTGG 0: 1
1: 0
2: 7
3: 47
4: 431
1167208099_1167208111 20 Left 1167208099 19:48116002-48116024 CCAGCGACCCCCTGCTCAGTCTC 0: 1
1: 0
2: 0
3: 13
4: 239
Right 1167208111 19:48116045-48116067 TGTTTCCTGATCCACATGACGGG 0: 1
1: 0
2: 1
3: 14
4: 180
1167208099_1167208112 21 Left 1167208099 19:48116002-48116024 CCAGCGACCCCCTGCTCAGTCTC 0: 1
1: 0
2: 0
3: 13
4: 239
Right 1167208112 19:48116046-48116068 GTTTCCTGATCCACATGACGGGG 0: 1
1: 0
2: 0
3: 12
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167208099 Original CRISPR GAGACTGAGCAGGGGGTCGC TGG (reversed) Intronic
900137136 1:1122394-1122416 GACCCTGAGCAGGGGTTCTCAGG + Intergenic
900479370 1:2890619-2890641 GAGGCTCAGCAGGGGGTGACAGG - Intergenic
900800146 1:4732224-4732246 GAGACTGAGAAGGGAGCAGCTGG + Intronic
900946664 1:5834696-5834718 GGTGCTGAGGAGGGGGTCGCAGG + Intergenic
901762343 1:11479307-11479329 GAGAGTGCGCAGAGGGTCGGGGG - Exonic
902185909 1:14725308-14725330 GAGCCTAAGGAGGGGGTCCCAGG - Intronic
902458745 1:16554963-16554985 GAGACTGAGCAAGGGGACCAGGG + Intergenic
902493412 1:16852953-16852975 GAGACTGAGCAAGGGGACCAGGG - Intronic
902781534 1:18708189-18708211 GAGAGTGGGCTGGGGGTTGCGGG - Intronic
903151935 1:21415722-21415744 GAGACTGAGCAAGGGGACCAGGG + Intergenic
903614740 1:24643514-24643536 GAGACTGCGCAGGGGCGCACCGG - Intronic
903777044 1:25800109-25800131 GGGGCTGGGCGGGGGGTCGCTGG - Intergenic
904043531 1:27597636-27597658 GAAACTGAGCCGGGGGTGGAAGG + Intronic
904239364 1:29134204-29134226 GATACTGAGCTGCGCGTCGCTGG + Intergenic
904563426 1:31413483-31413505 AGGACTGAGCAGGGGGACGGGGG - Intronic
904595830 1:31644765-31644787 GAGAAAGAGCAGGGGGACGTCGG + Intronic
904938442 1:34148333-34148355 GAGACTGGGCAAGGGGCCGGTGG - Intronic
905370125 1:37478552-37478574 GGGAATGAGCAGGGATTCGCAGG - Intronic
906062340 1:42957397-42957419 GAGACTGAGCGGGGTGGCGCTGG - Intronic
907414445 1:54304508-54304530 GAGGCTGAGTAGGGAGTTGCAGG + Intronic
911449474 1:98045666-98045688 GAAGCTGGGCAGAGGGTCGCTGG - Intergenic
913156973 1:116109160-116109182 GAGACTCAGAAGGGGGACGTGGG + Intergenic
913476056 1:119239217-119239239 GAAACTGAGAAGGGTGTCGGTGG + Intergenic
913988441 1:143586187-143586209 GAGACTGAGCAAGGGGACCAGGG + Intergenic
914209530 1:145564725-145564747 GAGACTGAGCAAGGGGACCAGGG + Intergenic
914268447 1:146057093-146057115 GAGACTGAGCAAGGGGACCAGGG + Intergenic
914368645 1:147003771-147003793 GAGACTGAGCAAGGGGACCAGGG - Intergenic
914385552 1:147166385-147166407 GAGAGAGAGCAGGGGGTTGGGGG - Intronic
914584289 1:149046419-149046441 GAGACTGAGCAAGGGGACCAGGG + Intronic
915016717 1:152741161-152741183 GAGCCTGAGGAGGGGGTCATGGG - Intronic
915836623 1:159181819-159181841 GAGACTGGGAAGTGGGTGGCAGG - Intronic
917521659 1:175752846-175752868 GAAACTCAGCAGGGTGTCGAGGG + Intergenic
918002434 1:180510084-180510106 GAGACTCAGCAGGGGGAGGGTGG - Intergenic
918558692 1:185838027-185838049 GAGACTGAGAGGGAGGTCCCTGG + Intronic
922043437 1:221919540-221919562 GAGACTGAGCAGATGCTGGCAGG + Intergenic
922239574 1:223746878-223746900 GAATGTGAGCAGGGGGTCCCTGG + Intronic
923880900 1:238103173-238103195 GAGACTCAGCAGGGGGAAGGGGG - Intergenic
924113171 1:240720289-240720311 AAGAGTGAGCAGGGGGTCTGGGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1065140407 10:22714207-22714229 GACGCTGAGCAGCGGGTCGCTGG + Exonic
1069063928 10:63922912-63922934 CAGACTGAGCAGGAGGGCGTCGG + Intergenic
1069849046 10:71393279-71393301 GAGATTGACCAGGAGGTCACAGG - Intergenic
1070459657 10:76651468-76651490 GAGGCTGAGGAGGGGGTTCCGGG + Intergenic
1071015961 10:80997464-80997486 GAGCCTGAGCAGGGACTCACAGG - Intergenic
1071086585 10:81874403-81874425 GAGACTGCGTCGGGGGTCCCGGG - Intergenic
1071156042 10:82690910-82690932 GAGAATGAGCAGGGGCTGTCAGG - Intronic
1073138822 10:101234470-101234492 GAGACAGAGCAGGAGGTGCCAGG - Intergenic
1074569985 10:114615458-114615480 GAAACTGAGATGGGGGTCGGAGG - Intronic
1075399689 10:122151956-122151978 GACTCTGGGCAGGGGCTCGCTGG + Intronic
1076804324 10:132847518-132847540 GAGCCTGGGCAAGGGGACGCTGG + Intronic
1076839424 10:133038746-133038768 GGGTCTGAGCAGTGGGTCCCTGG + Intergenic
1076891966 10:133289249-133289271 CAGACTGAGCTGGTGGTGGCAGG + Intronic
1077064807 11:636506-636528 GACCCTGGGCAGGGGGTCCCGGG - Intergenic
1077266790 11:1654884-1654906 GAGGCTGGGCAGGGGGTAGGGGG + Intergenic
1077282324 11:1751286-1751308 GAGAGGGAGCCAGGGGTCGCAGG + Intronic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081990185 11:47333372-47333394 GACAGTGAGCAGGGGGTCACTGG + Intronic
1082752807 11:57038807-57038829 AAGACTCAGCAGGGGGTAGAGGG + Intergenic
1082995702 11:59253267-59253289 GAGACTGTGCAGGGTTACGCAGG + Intergenic
1083195403 11:61082923-61082945 GAGGGTCAGCAGGGGGTCCCAGG - Intergenic
1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG + Exonic
1084509346 11:69593571-69593593 GGGACTGAGCAGGGGGCGTCGGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084694883 11:70747047-70747069 GAGACTGAGCAGGGAGTGCAGGG - Intronic
1085276956 11:75306642-75306664 GAGCCTGAGCTGGGGGCTGCAGG + Intronic
1088532957 11:110830446-110830468 GAGACAGAGCAGGGCGTTACAGG + Intergenic
1089409701 11:118230237-118230259 GAGAGTGAGGAGAGGATCGCTGG - Intronic
1091007815 11:131969520-131969542 GAGACTGAGCAAGGGGAGGCAGG + Intronic
1092003538 12:5050249-5050271 GAGACAGATCAGGGCTTCGCAGG - Intergenic
1092196766 12:6554560-6554582 GGGACTGAGCAGGGAGAAGCTGG - Intronic
1092579163 12:9820406-9820428 GAGCCACAGCAGGGGGTGGCTGG - Intergenic
1102589252 12:113945311-113945333 AAGCCAGAGGAGGGGGTCGCTGG - Intronic
1103938010 12:124486647-124486669 GAGCCTGAGCAGGGAGTCCACGG - Intronic
1107307291 13:39036974-39036996 GAGACTCAGCACGGTGTCGTGGG - Intronic
1110689980 13:78421659-78421681 GAGACTGGGCGGGGGGATGCAGG - Intergenic
1111278777 13:85990367-85990389 GGGCCTGAGCAAGGGGTTGCTGG - Intergenic
1113788608 13:113015807-113015829 GAGAGAAAGCAGGGGGTCTCTGG + Intronic
1113947043 13:114050184-114050206 GACACTGAGCAAGGGGGTGCAGG + Intronic
1114540974 14:23458043-23458065 GAGTCTGAGGAGGGGGTCATGGG + Intergenic
1118281958 14:64437683-64437705 GAACCTGAGCAGGGGGTTGTGGG - Intronic
1119477496 14:74939517-74939539 GAGACTGAGGAAGGGGGTGCTGG + Intergenic
1120169734 14:81236404-81236426 GCCACAGAGCAGGGGGTGGCGGG - Intergenic
1120757428 14:88257335-88257357 GAGACTGGGAAGGGGGTCGTGGG - Intronic
1121612984 14:95293914-95293936 GAGACTGAGGAGGGAGTGGGAGG - Intronic
1122078006 14:99247936-99247958 GAGACAGAGCAGGCGGTCCTGGG + Intronic
1122484102 14:102066414-102066436 GGGACTGAAAAGGGGGTTGCTGG - Intergenic
1124384812 15:29198119-29198141 GACATGGAGCAGGGGGTGGCAGG - Intronic
1128078225 15:64841597-64841619 GAGACTGAGGCGAGGGTGGCGGG - Intergenic
1128338294 15:66802575-66802597 GAGTCTGAGGAGGGGGCCGTGGG - Intergenic
1132599994 16:769077-769099 GGGCCTGAGCAGGGGGGCCCGGG - Intergenic
1132974328 16:2703891-2703913 GTGACTGAGCTGGGGCTCTCAGG - Intronic
1133020131 16:2963537-2963559 GAGTCTGGGCTGGGGGTCCCAGG + Intergenic
1133544020 16:6787578-6787600 GAGACTGTGAAGGGTGTCACAGG - Intronic
1133594223 16:7275021-7275043 GAATCTGAGCAGGTGGTCGAAGG + Intronic
1133747198 16:8696270-8696292 GTGACTGTGCAGGGGGACCCTGG + Intronic
1135697562 16:24603388-24603410 GAGACAGAGCAGGGAGTCCAGGG - Intergenic
1137684250 16:50374780-50374802 GAGACTGAGGAGGGGGAGGGAGG + Intergenic
1139482732 16:67239478-67239500 GAGACTGAGGAAGAGGTGGCAGG + Intronic
1139612739 16:68070446-68070468 GAGACAGAGCAGGGGGTCCTTGG + Intronic
1140033653 16:71357495-71357517 GAGAATGAAAAGGAGGTCGCTGG - Intergenic
1141177912 16:81732840-81732862 GAGACCCAGCAGGGGGCAGCGGG - Intergenic
1141881791 16:86865124-86865146 GAGACTGGGCGGGGGGTTACGGG + Intergenic
1142525223 17:535444-535466 ATGACTGAGCAGGGAGACGCCGG + Intronic
1143942610 17:10558253-10558275 CAGACTCATCAGGGGGTAGCTGG + Intergenic
1144517447 17:15928457-15928479 GAGGCTGAGCATGGGGAGGCTGG + Intergenic
1144676144 17:17163100-17163122 CAGAATGAGCAGGGGGTCTGTGG + Intronic
1146229892 17:31097942-31097964 GAGGCCGAGCAGGGGGTGGGGGG - Intronic
1146529044 17:33592241-33592263 GACACAGAGCAGGGGGTCAATGG - Intronic
1152539058 17:80965766-80965788 GAGACTGAGCTGGGGCTGGCCGG + Exonic
1155121786 18:22828285-22828307 AAGACTGAGAAGGAGGTAGCTGG - Intronic
1155315133 18:24563737-24563759 GAGACTCAGAAGGGGGACGGTGG - Intergenic
1155886658 18:31216961-31216983 CAAACTAGGCAGGGGGTCGCAGG + Intergenic
1157268303 18:46248367-46248389 GAGGGTGAGCAGTGGGTGGCTGG + Intronic
1157452475 18:47799168-47799190 GAGACTGAACAGAGGCTTGCTGG + Intergenic
1160474298 18:79168249-79168271 GAGTCTGAGCAGGGGGTCCGTGG + Intronic
1160854279 19:1209219-1209241 GAGCCTGTGCTGGGGGTAGCAGG + Intronic
1161370412 19:3908121-3908143 GAGACTGGCTAAGGGGTCGCCGG + Intronic
1161378343 19:3951266-3951288 GAGGCTGACCAGGGGGACGGGGG + Intergenic
1161885126 19:6988680-6988702 GAGACAGAGCATGGAGTCTCTGG - Intergenic
1163104620 19:15116159-15116181 GAGCCAGCGCAGGGGGCCGCGGG + Exonic
1163287429 19:16357407-16357429 CAGACTGAGGAGGGGCTCGTGGG + Intronic
1163441660 19:17325008-17325030 GTGACTGGGCAGGGGGAGGCCGG + Exonic
1163449192 19:17365631-17365653 GAGGCTGGGCATGTGGTCGCAGG + Exonic
1166135625 19:40775504-40775526 GAGAGTGAGCAAGGGGGTGCTGG - Exonic
1166698833 19:44870200-44870222 GAGACTGAGGAGGGCGTGGATGG + Intronic
1167208099 19:48116002-48116024 GAGACTGAGCAGGGGGTCGCTGG - Intronic
1167210007 19:48128321-48128343 GAGGCTGAGCAGGGAGTTGGTGG - Intronic
1168323684 19:55526036-55526058 GAGACTGGGCAGGGGGCAGGGGG - Intergenic
1202708795 1_KI270714v1_random:5166-5188 GAGACTGAGCAAGGGGACCAGGG - Intergenic
926173459 2:10568846-10568868 GGGACTGAGCTGGGGGTTCCTGG - Intergenic
927256285 2:21043664-21043686 GGGGCTGAGGAGGGGGTCTCCGG - Intronic
927672567 2:25081596-25081618 GAGCCTGAGCAGTGGCCCGCAGG + Intronic
929914317 2:46121488-46121510 CAGACTGGGCAGGGAGTTGCAGG - Intronic
931561508 2:63566843-63566865 GAACCTGAGGAGGGGGTCGTGGG - Intronic
933744384 2:85560202-85560224 GAAACAGAGCAGGGGGCCACAGG - Intronic
934080557 2:88464115-88464137 AAGCCTGGGCAGGGGGTGGCCGG - Intergenic
935292573 2:101622547-101622569 GACAAGGGGCAGGGGGTCGCCGG - Intergenic
936997829 2:118433898-118433920 GTGGCTGGGCAGGGGGTAGCAGG + Intergenic
939580094 2:143937282-143937304 GAGACTGAGCTAGGCGTCGAGGG + Intergenic
940130964 2:150381413-150381435 GAGACTCAGAAGTGGGTGGCAGG - Intergenic
942745283 2:179224964-179224986 AAAACTGAGGAGGGGGTCACGGG + Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
946075721 2:217071997-217072019 GACACTGAGCAGGGAGAGGCAGG + Intergenic
946148165 2:217746520-217746542 GAGACTTATCAGGAGGTGGCTGG - Intronic
946180753 2:217947520-217947542 GAGATGGAGCTGGGGGTGGCGGG + Intronic
946403589 2:219481400-219481422 GAGCCTGAGCAGGGAGGCCCGGG + Exonic
948375644 2:237518660-237518682 GTGGCTGAGGAGGGGGTGGCTGG - Intronic
948465632 2:238150386-238150408 TAGACTGAGCAGGGGGTGCAGGG + Intronic
949026196 2:241767589-241767611 GAGGCTCAGCCGGGGGTCTCGGG + Intronic
949041503 2:241851940-241851962 GAGACTCACCAGGGGCTGGCCGG + Exonic
1170297195 20:14840516-14840538 GAGACTGGGCATGGGGGCTCAGG - Intronic
1170770602 20:19329000-19329022 GGGAGTGAGCAGTGGGTTGCAGG + Intronic
1171388870 20:24788185-24788207 GAGACTCAGAAGGGGGAGGCTGG - Intergenic
1171975766 20:31593778-31593800 GAGACTGGGCAAGAGGTCTCTGG - Intergenic
1172167157 20:32906479-32906501 GAGACTGAGCCTGGGGTGGGAGG - Intronic
1173210650 20:41029148-41029170 GGGCCTGCGCCGGGGGTCGCGGG - Intronic
1173254891 20:41387275-41387297 GACTCTGAGCAGGGGCTCCCAGG + Intergenic
1174269642 20:49358394-49358416 GAGTCTGAGAAGGGGGTCTGTGG + Intergenic
1175310859 20:58010865-58010887 GAGACGGAGAAGGTGGTCGAGGG + Intergenic
1179056909 21:37944739-37944761 GAGTCTGGGCAGGGGGCTGCTGG + Intergenic
1183096914 22:35557752-35557774 GAGGCTGAGAAGGGGGTGGAGGG + Intergenic
1183411119 22:37655523-37655545 GAGACTGGGCTGGGGGAGGCTGG - Exonic
1183721273 22:39562925-39562947 GTGACTGCGGAGGGGGTCCCAGG + Intergenic
1183735610 22:39643288-39643310 GAGACTGAGCAGGGTTTGGAGGG + Intronic
1183748836 22:39707635-39707657 AAGCCTGAGCAGGGGGTGCCTGG - Intergenic
1183951114 22:41353669-41353691 GAGGCTGACCAGGGTGTGGCAGG + Intronic
1184190155 22:42889141-42889163 GAGACGGAGCATGGGGTGGGTGG + Intronic
1184995963 22:48207793-48207815 GTGACTGAGCAGGGAGTCAGAGG - Intergenic
950764313 3:15262010-15262032 GAGCCTGAGCAGGGGGGCTCTGG + Intronic
953238662 3:41128156-41128178 GAGGGTGAGCAGGGGGACGGGGG + Intergenic
953400279 3:42608316-42608338 GAAGCTGAGCAGGGGGTTGTAGG - Intronic
953404910 3:42655257-42655279 CAGACTGAGCAAGGGGGCACAGG - Intronic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954443959 3:50536623-50536645 GAGGCTGAGCAGGGAGTGGGTGG - Intergenic
954674418 3:52307882-52307904 GAGACGGAGCAGGGCCTCCCTGG - Intergenic
955386783 3:58487032-58487054 GAAAATGAGCAGTGGGTCCCAGG + Intergenic
956525045 3:70149509-70149531 GAAACTTGGCAGGGGGTAGCAGG + Intergenic
961535091 3:127565753-127565775 GAGCCTGAGCAGGGCATGGCAGG - Intergenic
964492274 3:157249630-157249652 GAGACAGAGGAGGGGGCTGCTGG - Intergenic
967126327 3:186427776-186427798 GAGACTGAGCAGGAGGGTGCTGG - Intergenic
968596518 4:1488903-1488925 GAGACTGTGCAGAGAGTCGGGGG - Intergenic
969841555 4:9886771-9886793 CAGACTGAGAAGGGGGGCTCAGG - Intronic
981554361 4:145976903-145976925 GAGACTGAGCAGGGTGAGGAGGG + Intergenic
981616226 4:146647664-146647686 GAGACTGAGAAGCAGGACGCGGG + Intergenic
984349393 4:178570858-178570880 GAGAATGAGGAGGGGGCCCCAGG + Intergenic
985652161 5:1112260-1112282 GAGACTGAGCGGGGATTCGCGGG - Intergenic
985702705 5:1383243-1383265 GAGGGTGAGCAGGGGGTTGGGGG - Intergenic
987920576 5:24274868-24274890 GAGACTGGGAAGGGGGTAGGGGG + Intergenic
988448719 5:31317869-31317891 GGGACTGAGCACGGGGGCTCTGG + Exonic
989189557 5:38657152-38657174 GAGAGTGAGGAGGGAGTGGCAGG - Intergenic
989643130 5:43602926-43602948 GAGGCTGGGCTGGGGGCCGCAGG + Intronic
994981174 5:106876239-106876261 CAGACTGAGTGGGGGGTCTCAGG + Intergenic
996170797 5:120288213-120288235 GAGAATGAGCATGGTGTTGCTGG - Intergenic
997042847 5:130278100-130278122 GAGACTGAGTAGGGGGCTGAGGG - Intergenic
997615921 5:135246146-135246168 GAGAGTGAGCAGGGAGGGGCAGG + Intronic
997806859 5:136926863-136926885 GAGCTTGGGCAGGGGGTGGCAGG - Intergenic
998004152 5:138646283-138646305 GAGACTGAGCAGGGAGGCAGGGG - Intronic
998207121 5:140165876-140165898 GGGACTGAGCAGGGGTGGGCGGG + Intergenic
998277900 5:140776127-140776149 GACACTGAACTGGGGGTAGCGGG - Intergenic
999950587 5:156645656-156645678 GTGACTGAGTAAGGGGTCGGAGG - Intronic
1000048479 5:157541390-157541412 CAGACAGAGCAGGGGGCAGCAGG - Intronic
1002329745 5:178433236-178433258 GAGCCTGAGGAGGCGGTCGTGGG - Intronic
1002784978 6:393414-393436 GAGACAGAGCCCGGGGTCCCCGG + Intronic
1003361219 6:5427514-5427536 GAAACTGAGCAGAGGATCTCAGG + Intronic
1003915931 6:10786348-10786370 GAGACCAAGCAGGGGATGGCAGG + Intronic
1008091995 6:47303398-47303420 GGGACTGAGCAGGGTGTGGGTGG - Intronic
1009681360 6:66897256-66897278 CAGACTGAGTGGGGGGTCTCTGG - Intergenic
1011038610 6:83005499-83005521 GAGACTGAGCATGGTGGCTCAGG + Intronic
1012474026 6:99602040-99602062 GTGACAGAGCAGGGGGTTGGGGG + Intergenic
1013073783 6:106752508-106752530 GATACTGAACACGGGGTGGCGGG + Intergenic
1017092278 6:150770756-150770778 GAAACTGTGCAGGGGCTCACAGG - Intronic
1018025229 6:159800436-159800458 GAGCTTGAGGAGGGGGTGGCGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1020032168 7:4940737-4940759 GAAACTGAGCAAGGGGTGGAAGG + Intronic
1020211054 7:6158551-6158573 GAGAGAGAGCTGGGGGTTGCGGG + Intronic
1022838003 7:34135327-34135349 AAGGCTGAGCAGGGGAGCGCAGG + Intronic
1024676860 7:51645207-51645229 GAGCCTGAGCAGGGTGGGGCTGG - Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1026981941 7:74532068-74532090 GGCACTGACCAAGGGGTCGCTGG - Intronic
1028280978 7:88927445-88927467 CAGACTGAGCATGGTGTCTCAGG - Intronic
1029619126 7:101679073-101679095 GAGTCTGAGCAGGGGGTCTGTGG - Intergenic
1035367595 7:158359138-158359160 GGGTCTGAGCAGGGACTCGCCGG - Intronic
1036146291 8:6257856-6257878 GGCACTGAGGAGGGGGTCGGTGG + Intergenic
1036644631 8:10604414-10604436 GAAACTGAGTTGGGGGTCACTGG + Intergenic
1038278515 8:26141857-26141879 GAGAGGGAGCAAGGGGTGGCGGG - Intergenic
1039965653 8:42281682-42281704 GAGACTGGGCAGGAGGACCCAGG - Intronic
1041044686 8:53879362-53879384 GAGCCTCGGGAGGGGGTCGCCGG - Exonic
1043613855 8:82101165-82101187 GAGACTGAGCCAGGAGTCTCAGG + Intergenic
1044253990 8:90038430-90038452 GAGAGAGAGCAGGGCATCGCGGG + Intronic
1047319662 8:123768051-123768073 GAGACGGGGCGGGGGGTTGCGGG - Intergenic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049558910 8:143297660-143297682 GAACCTGAGAAGGGGGTCGTGGG + Exonic
1051626241 9:19102472-19102494 GAGCCTGAACCGGGGGACGCCGG - Intronic
1051683919 9:19637299-19637321 GAGACTGGGCAGGGTGCCGGAGG + Intronic
1058587463 9:106525605-106525627 GAGACTCAGAAGGGGGTGGGTGG + Intergenic
1061316561 9:129799902-129799924 GAGAAGGAGCATGGGGCCGCTGG - Intergenic
1061508411 9:131045829-131045851 GGGAGGGAGCTGGGGGTCGCAGG - Intronic
1062158885 9:135068986-135069008 GAGTCTGTGCCGGGTGTCGCTGG + Intergenic
1062334005 9:136056979-136057001 GGGACACAGCAGGGGGTCTCTGG + Intronic
1185432383 X:18107-18129 GAGGAGGAGCAGGGGGTCGGGGG - Intergenic
1190107845 X:47572224-47572246 GAAACTGGGGAGGGGGTCCCTGG + Exonic
1190116136 X:47627284-47627306 GAGGCTGAGCAGGGGGTCCAGGG + Exonic
1192177080 X:68892912-68892934 CAGACTGAGCTGGGGCTCGATGG - Intergenic
1196138777 X:112238184-112238206 GAGACTGAGCTGGTGGTCAAAGG - Intergenic
1196433551 X:115653750-115653772 AAAACTGAGCAGGGTGTGGCCGG - Intergenic
1196756214 X:119159683-119159705 GAGACTAAGCTGGGGGTTGGAGG - Intergenic
1198629351 X:138617641-138617663 GAGAGTGAGAAGGGGATAGCTGG + Intergenic
1199329582 X:146543139-146543161 GAGGCTGTGCAGGGGGTCAGTGG + Intergenic
1199600859 X:149540368-149540390 GAGAATCAGCAGGGGGAGGCAGG - Intronic
1200044891 X:153396159-153396181 GGGACTGCGCTGGGGGTCTCCGG + Intergenic
1200069227 X:153519582-153519604 GAGACCCAGCAGAGGGTCCCAGG + Intronic