ID: 1167209224

View in Genome Browser
Species Human (GRCh38)
Location 19:48122647-48122669
Sequence CCTGGCCCGACACGGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167209212_1167209224 27 Left 1167209212 19:48122597-48122619 CCTGCCTGACTTTCTCTTATTCA No data
Right 1167209224 19:48122647-48122669 CCTGGCCCGACACGGGCGGCAGG No data
1167209213_1167209224 23 Left 1167209213 19:48122601-48122623 CCTGACTTTCTCTTATTCATGTC No data
Right 1167209224 19:48122647-48122669 CCTGGCCCGACACGGGCGGCAGG No data
1167209215_1167209224 1 Left 1167209215 19:48122623-48122645 CCTGGCTTAATTCCTGCCCAAGA No data
Right 1167209224 19:48122647-48122669 CCTGGCCCGACACGGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167209224 Original CRISPR CCTGGCCCGACACGGGCGGC AGG Intronic