ID: 1167209343

View in Genome Browser
Species Human (GRCh38)
Location 19:48123273-48123295
Sequence CCCGGAGCAGCTGCCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167209338_1167209343 -2 Left 1167209338 19:48123252-48123274 CCTCTGTCTCCACAAAGTTCTCC 0: 1
1: 0
2: 2
3: 31
4: 291
Right 1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG 0: 1
1: 0
2: 3
3: 47
4: 370
1167209336_1167209343 25 Left 1167209336 19:48123225-48123247 CCAGGGAGGTGGCGAAGACAAAC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG 0: 1
1: 0
2: 3
3: 47
4: 370
1167209337_1167209343 -1 Left 1167209337 19:48123251-48123273 CCCTCTGTCTCCACAAAGTTCTC 0: 1
1: 0
2: 1
3: 41
4: 340
Right 1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG 0: 1
1: 0
2: 3
3: 47
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167209343 Original CRISPR CCCGGAGCAGCTGCCGGCGC CGG Exonic
900091748 1:923865-923887 CCCGGCGCGGCGGGCGGCGCGGG - Intergenic
900110526 1:1003646-1003668 TCCTGAGCAGCTTCCGGCGCAGG + Intergenic
900124868 1:1064824-1064846 CCCGGGGCAGCTGCCCTCGGTGG + Intergenic
900226591 1:1536043-1536065 GCGGGACCAGCTGCCGGCGAGGG + Intronic
900578036 1:3393998-3394020 CCTGGAGCCGCCGCCGCCGCGGG - Intronic
900598891 1:3494647-3494669 ACAGGAGCAGCTGCCGTTGCTGG + Exonic
901500796 1:9651777-9651799 CCCGGCGCAGCTGGCAGGGCTGG - Exonic
901649764 1:10736890-10736912 CCAGGAGCACCTGCAGGCCCGGG - Intronic
901660288 1:10794819-10794841 CGCGGAGGAGCTTCCAGCGCCGG + Intronic
901828469 1:11878161-11878183 CCCTGAGCAGCAGCCTGAGCTGG + Intergenic
902385388 1:16073064-16073086 CCCGGAGGAACTGCGGGCACCGG - Intronic
902500053 1:16904864-16904886 CCCGGTGCCGCAGCCGGCGGGGG - Intronic
903124519 1:21238546-21238568 CACGGAGCAGCTGCTGGCCCAGG + Intronic
903130573 1:21277057-21277079 CCAGGAGCAGGTGCTGGTGCTGG - Intronic
904241503 1:29149190-29149212 CCCGGAGCAAGAGCCGGAGCCGG - Exonic
904419549 1:30382772-30382794 CCAGGAGCATCTGCTGGGGCGGG + Intergenic
904613287 1:31736753-31736775 CCCTGAGCAGCCGCCAGGGCAGG + Intronic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
905912141 1:41662341-41662363 CCCGGAGCCGCGCCCGCCGCCGG - Intronic
909475203 1:76074592-76074614 CACTGAGGAGCCGCCGGCGCCGG + Intergenic
910237338 1:85048754-85048776 TCCGGAGCTGCCGCCGGCGCCGG + Intronic
910371784 1:86524031-86524053 CCCTCAGCAGCTGCTGGCCCAGG + Intergenic
915070388 1:153261296-153261318 CCCGGAGGAGCCGCCGCCACCGG - Exonic
917737240 1:177932515-177932537 GGGGGAGCAGCTGCGGGCGCTGG - Exonic
919748537 1:201023214-201023236 CCCGGAGGAGGGGCCGGCGTGGG - Intronic
919802985 1:201364667-201364689 CACAGAGCAGCTGCCAGGGCAGG - Intronic
919841749 1:201614367-201614389 CCCGCAGCAGCTGCCGGGGTTGG - Intergenic
921196180 1:212760118-212760140 CCAGAAGCAGCTGGCGGGGCAGG - Intronic
922950922 1:229558267-229558289 CCCGCAGCCGCTGCCTGGGCAGG - Exonic
923478195 1:234357000-234357022 CCCGGTTCAGCCGCCGCCGCTGG + Intergenic
924436856 1:244049402-244049424 CCCGGAGCCGCGGCCGTCCCGGG - Intronic
1063414563 10:5863009-5863031 CCCGGAGCAGCTGACTGTGGTGG + Intronic
1063980511 10:11448115-11448137 CCTGGAGCAGCTTCCAGCGAGGG - Intergenic
1064016171 10:11774051-11774073 CCCGGGGCAGCTGTCGGAGCAGG - Intergenic
1064254511 10:13732594-13732616 GCAGGAGCAGCTGCCTGGGCTGG + Intronic
1064645436 10:17454553-17454575 CTCGGAGCTGCTGCGGGCTCCGG + Intergenic
1065140377 10:22714095-22714117 CCCGCAGCAGCTGCAGCCGGAGG + Intronic
1065687710 10:28302772-28302794 CCCGAAGCTGCTCCCTGCGCCGG - Intronic
1065968180 10:30785323-30785345 CCAGGAGCAGCTGCGGAGGCCGG - Intergenic
1067363241 10:45601062-45601084 CCTGGAGCAGGGGGCGGCGCTGG - Intergenic
1067372702 10:45699928-45699950 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067375897 10:45727437-45727459 CCAGGAGCTGGTGCCGGCGTCGG + Exonic
1067387075 10:45826196-45826218 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067419053 10:46131055-46131077 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067447196 10:46358411-46358433 CCCGCAGCAGGTGCTGGCCCAGG - Intergenic
1067504404 10:46837644-46837666 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067590182 10:47502349-47502371 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067876187 10:50009883-50009905 CCCGCAGCAGCTGCTGGCCCAGG - Exonic
1068216673 10:53990950-53990972 CCCTCTGCAGCTGCCGGCCCGGG - Intronic
1068763042 10:60733512-60733534 CCCGGCGCACCGGCCCGCGCGGG - Intergenic
1069504935 10:68989153-68989175 CACGGAGGAGCTGTCGGCGGGGG + Exonic
1069566508 10:69466946-69466968 CCCAGGCCAGCTGCAGGCGCTGG - Intronic
1070133899 10:73674880-73674902 CCCGCAGCAGGTGCTGGCCCAGG + Exonic
1071607814 10:87009602-87009624 CCCGCAGCAGGTGCTGGCCCAGG - Intergenic
1073051143 10:100668160-100668182 CCTGGAGATGCTGCCGGCTCAGG - Intergenic
1073249799 10:102114593-102114615 CCCGGGACAGCGGCCGCCGCGGG - Intronic
1073292743 10:102421408-102421430 GCCGGAGCAGCTGGCGCAGCGGG - Exonic
1073414271 10:103368227-103368249 TCCGGAGCAGCGGCGGGCACCGG - Exonic
1075334206 10:121597382-121597404 CCCGCAGCCGCCGTCGGCGCTGG - Intronic
1076732890 10:132447114-132447136 CCGGGAGCAGCTGCTGGGGCGGG + Intronic
1076764829 10:132627341-132627363 CCAGCAGCAGCTCCCGGCCCCGG - Intronic
1076816097 10:132915370-132915392 CCCGGAGCTGCTGCAGGAGAGGG + Intronic
1076992065 11:280574-280596 CGCGGACGAGCTGCCGGCGCTGG + Exonic
1077184450 11:1229995-1230017 CCCGGAGCAGGTGCTGGGGAGGG - Exonic
1078053489 11:7987443-7987465 ACCGGAGCCGCAGCCGGTGCTGG - Exonic
1078256583 11:9664027-9664049 CCCCGCCCTGCTGCCGGCGCCGG - Intergenic
1078631918 11:13010662-13010684 CCAGGAGGAGCTGGCGGCGCGGG + Intergenic
1080418545 11:32091235-32091257 CCTGGGGCTGCTGCTGGCGCTGG + Exonic
1080685758 11:34513557-34513579 CCCAGCGCAGGTGCCGGCCCTGG + Intronic
1081700146 11:45147365-45147387 CCCGCAGCAGCCCCCGGCGCGGG - Exonic
1083039127 11:59669081-59669103 CCCTGCGCAGCCGCCGCCGCCGG - Intergenic
1083178643 11:60970506-60970528 GCGGCAGCAGGTGCCGGCGCTGG + Intergenic
1083271442 11:61574859-61574881 CCGGGAGCAGCTGCCGCGGCAGG + Intronic
1083329617 11:61891472-61891494 GCCGGAGCAGCGGGCGGCGGCGG - Exonic
1083578932 11:63813064-63813086 CCCGGGGCATCTGCTGGCGGAGG + Intergenic
1083800137 11:65041742-65041764 CCCGGTGCTGCTGCAGGCCCAGG + Exonic
1084146144 11:67266408-67266430 CCCGGAGCCGCCGCCGCCTCCGG - Exonic
1084196115 11:67524247-67524269 CCCGGAGAAGCTCTCGTCGCCGG + Intergenic
1084732185 11:71080782-71080804 CACGGAGCAGCTGGTGGCTCAGG - Intronic
1084888513 11:72225074-72225096 CGCGGAGGAGCTGCTGGCCCGGG + Exonic
1085473642 11:76774143-76774165 TCCTGAGCAGCTGCCAGAGCTGG - Intergenic
1085503073 11:77040052-77040074 CGCGGAGCGGCTGGCGGAGCTGG + Exonic
1085642417 11:78200718-78200740 CCTGGAGCAGCTGGCGGAGCTGG + Exonic
1086034907 11:82404040-82404062 CCCTCCGCAGCTGCCGGCCCGGG - Intergenic
1089499287 11:118923119-118923141 GCAGCAGCAGCTGCCGGGGCAGG - Intronic
1089543714 11:119206449-119206471 CCCGGAGCCGCTGCCGCCCCCGG - Exonic
1090401577 11:126452749-126452771 ACCGGAGCCGCTGTCGGGGCTGG + Intronic
1091124251 11:133082103-133082125 CCCAGAGCAGCTCCCGGCTCAGG + Intronic
1091284454 11:134400263-134400285 CCCGGAGGAGCTTCTGGCTCGGG - Intronic
1091402204 12:188156-188178 CCTGGAGCAGGGGGCGGCGCTGG + Intergenic
1091791229 12:3273369-3273391 CCCGGAGCAGGTGCAGGTCCAGG - Intronic
1095444956 12:42273924-42273946 CCCTCCGCAGCTGCTGGCGCGGG + Intronic
1098369136 12:69738842-69738864 CCCGGCCCCGCTTCCGGCGCAGG + Intronic
1101813670 12:108129474-108129496 CCCGGGGCGGGTGCCCGCGCGGG + Intronic
1102115990 12:110403404-110403426 CCCGGAGCCTCCGCTGGCGCCGG + Intronic
1103209581 12:119156710-119156732 GCCGGAGCAGGAGCCGGAGCCGG + Exonic
1103563347 12:121803884-121803906 GGCGGCGCAGCTGCCGCCGCCGG + Intergenic
1103614158 12:122141743-122141765 CCCGGCACAGCTGCCAGAGCAGG + Exonic
1104289681 12:127455965-127455987 CCCGGAGCCGCTGCTCGAGCTGG - Intergenic
1104568213 12:129903708-129903730 CCGGGAGCAGCTGGAGCCGCCGG - Intergenic
1104761244 12:131298728-131298750 CCCGGAGGCGATGCCGGCCCGGG - Intergenic
1104818531 12:131662064-131662086 CCCGGAGGCGATGCCGGCCCGGG + Intergenic
1104857779 12:131909940-131909962 CCAGGAGCAGCTGCCGCAGCGGG - Exonic
1104881689 12:132075835-132075857 CCCCCAGCAGCTGCCCACGCTGG + Intronic
1104956227 12:132467100-132467122 CCCGGAGCAGCTCCAGGTCCAGG + Intergenic
1105017771 12:132796538-132796560 CCTGGAGCAGCAGCTGGAGCAGG - Exonic
1105296458 13:19091073-19091095 GCCTGAGCAGCTGCAGGGGCAGG + Intergenic
1106269464 13:28139027-28139049 ACCGGAGCCGCAGCCGGCGGAGG + Exonic
1107942990 13:45391288-45391310 CCTGGGGCTGCTGCTGGCGCTGG - Intergenic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1112506767 13:99980586-99980608 CCCTGAGCTGCTGCCGGCTCAGG - Intergenic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119172638 14:72546629-72546651 CCAGGAGCAGCTGCCTCCACCGG - Intronic
1122514534 14:102297824-102297846 CCCTCAGCAGCTGCTGGCCCGGG - Intronic
1122542756 14:102507193-102507215 CCAGCAGCAGCAGGCGGCGCTGG + Exonic
1123468896 15:20535671-20535693 CCAGCAGCAGCTGCAGGCGGAGG - Exonic
1123649160 15:22465019-22465041 CCAGCAGCAGCTGCAGGCGGAGG + Exonic
1123729171 15:23130654-23130676 CCAGCAGCAGCTGCAGGCGGAGG - Exonic
1123747339 15:23328140-23328162 CCAGCAGCAGCTGCAGGCGGAGG - Intergenic
1123774183 15:23562064-23562086 GCCCTTGCAGCTGCCGGCGCAGG + Intergenic
1124279700 15:28351993-28352015 CCAGCAGCAGCTGCAGGCGGAGG - Intergenic
1124302998 15:28559615-28559637 CCAGCAGCAGCTGCAGGCGGAGG + Intergenic
1124848267 15:33311675-33311697 CCAGCAGCAGTTGCCGGCGTGGG - Intronic
1125287840 15:38112955-38112977 CCCGAGGCAGCTGCCTGCTCCGG - Intergenic
1125927648 15:43576437-43576459 CCTTGAGCAGCTGCCAGCACCGG - Exonic
1125940791 15:43676002-43676024 CCTTGAGCAGCTGCCAGCACCGG - Intergenic
1127695977 15:61448205-61448227 CCAGAAGCAGCTGCCAGCTCTGG - Intergenic
1127995725 15:64152230-64152252 CTCGGAACACCTGGCGGCGCGGG - Exonic
1131260349 15:90884523-90884545 CCAGGAGCAGCTGCCCGTGCGGG + Exonic
1132542139 16:515433-515455 ACCGGTGTAGCTGCTGGCGCAGG - Intronic
1132561881 16:598952-598974 CCAGCAGCAGCCGCCGGCCCCGG - Intronic
1132583131 16:694367-694389 CCTGGTGCAGCTGCAGGAGCTGG - Exonic
1132591105 16:726878-726900 CCTGGAGGAGGTGCCAGCGCCGG + Intronic
1132734802 16:1379932-1379954 CCCGGAGCAGCTGCAGGTGCAGG - Intronic
1132747642 16:1443601-1443623 CCTGGAGCAGCTCCCGCAGCAGG + Exonic
1133058462 16:3159083-3159105 TCCGTGGCAGCTGCAGGCGCCGG + Intergenic
1134098550 16:11435748-11435770 CTCGGAGGAGCAGCCGGGGCTGG - Exonic
1134810895 16:17166217-17166239 CCTGGAGCAGCTGCTGCAGCTGG + Intronic
1135247426 16:20869039-20869061 CCAGGAACAGCGGCCAGCGCTGG - Intronic
1135298325 16:21301935-21301957 CGGGGAGCAGCTGCAAGCGCAGG - Intronic
1136394402 16:29985296-29985318 CCAGAAGCAGCTGCTGGCCCTGG + Exonic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1136458456 16:30395491-30395513 CCCGGAGCCGCTGGCGGCTCGGG + Exonic
1136556468 16:31010430-31010452 CCCGGAGCAGCAGCAGAGGCAGG - Exonic
1137731468 16:50693579-50693601 CCCGGAGCCGCAGCCCGAGCCGG + Intergenic
1138611670 16:58129695-58129717 CCGGGAGTAGTTGCCCGCGCGGG + Intergenic
1141172428 16:81699881-81699903 CCAGGAGCTGCTGCAGGCACGGG + Intronic
1141608844 16:85170167-85170189 CCCGGAGCGGGTCCCGGAGCCGG - Intergenic
1141728520 16:85806885-85806907 CCAGGCGCAGGTGCAGGCGCAGG - Exonic
1142001729 16:87668161-87668183 CCCGGAGCGGCTGGAGGGGCAGG - Intronic
1142549798 17:731990-732012 CCCGGAGCGGCTGCAGCCGCTGG + Intergenic
1142610879 17:1108788-1108810 CCGGGAACAGCTGCCGGGGCCGG + Intronic
1143174615 17:4948984-4949006 CCCGGCGCAGGCGCAGGCGCGGG - Exonic
1143460470 17:7100633-7100655 CCTGGAGCAGGGGGCGGCGCTGG + Intergenic
1143830419 17:9646061-9646083 CACCGAGCAGCTGGCGGCGCTGG + Exonic
1144729802 17:17519817-17519839 CTCAGAGCAGCTCCCGGGGCAGG + Intronic
1144952955 17:19003936-19003958 CGAGGAGCAGCGGCTGGCGCTGG - Exonic
1145059670 17:19724730-19724752 CTCAGAGCAGCCTCCGGCGCGGG + Intergenic
1145764563 17:27449478-27449500 GCCAGAGCAGCTGCAGGTGCTGG - Intergenic
1146208089 17:30922047-30922069 GCTGGAGCTGCTGCGGGCGCCGG + Exonic
1146794755 17:35773336-35773358 GCCTGAGCATCTGCCGGAGCCGG - Exonic
1147486357 17:40818873-40818895 GCCGGAGCTGCTGCCGCCGCCGG + Exonic
1147612765 17:41811504-41811526 CACGCAGCAGCTGCCGCGGCGGG + Exonic
1149431503 17:56597836-56597858 CCCGAAGCCGCTGCGGCCGCGGG + Intergenic
1149658439 17:58322534-58322556 CCTGGAGCAGCTCCAGGCCCAGG + Intronic
1150069548 17:62139561-62139583 CCCGCTGCAGCTGCCGCCCCCGG - Intergenic
1151495298 17:74454802-74454824 CCTGAAGCAGCTGGCAGCGCCGG - Intergenic
1152049233 17:77959233-77959255 CGCGGAGCCGCCGCCGCCGCCGG + Intergenic
1152101360 17:78303686-78303708 CACGGAGGAGCAGCCGGCCCTGG - Intergenic
1152197227 17:78924996-78925018 CGGGGAGCAGCTGCAGGCGTCGG + Exonic
1152544647 17:80994655-80994677 CCCGCAGCAGCTGCCGGGCCAGG - Exonic
1152648588 17:81481666-81481688 CCCGGAGCAGGGGTCCGCGCTGG + Intergenic
1152719730 17:81917686-81917708 CCCGGAGGAGCTGCGGGGGAAGG - Exonic
1152924015 17:83079490-83079512 CCGGGAGGAGTTTCCGGCGCGGG + Intergenic
1152924109 17:83079751-83079773 CCCGGAGCAGACCCCGGAGCCGG - Exonic
1154128714 18:11716985-11717007 CCTGGAGCAGGGGGCGGCGCTGG + Intronic
1154218289 18:12431590-12431612 CCCGGAGCAGCCGCGGGCCCAGG - Exonic
1154355254 18:13619716-13619738 CCCTGAGCAGCTCCCGAAGCTGG - Intronic
1155806304 18:30175339-30175361 CCCTCCGCAGCTGCTGGCGCGGG + Intergenic
1155928757 18:31684931-31684953 CCCGGAGTAGGAGGCGGCGCAGG - Intronic
1156008491 18:32470608-32470630 CCCGGCTCAGCTGCCGCTGCGGG + Intergenic
1159618254 18:70607227-70607249 CCCGGAGCTGCTGCAGGAGTTGG + Intergenic
1160025030 18:75209539-75209561 CCCGGGGCTGCCGCCGGCTCGGG - Intergenic
1160034178 18:75285973-75285995 CCCGGAGCTGCTGCTGGTACTGG - Exonic
1160475091 18:79176883-79176905 CACGCAACAGCTGCCGGCTCTGG + Exonic
1160717812 19:584358-584380 CCGGGAGCAGCTGCCGCCCGGGG - Intergenic
1160727672 19:624757-624779 CCCGCCGCAGCTGCCGCCCCCGG - Exonic
1160816858 19:1040083-1040105 CCCGGCGCTGCTACCTGCGCGGG + Exonic
1160830516 19:1102760-1102782 CCAGGGGCAGCTGCCCACGCAGG - Intergenic
1160903315 19:1440049-1440071 CCCGGTTCAGCCGCCGCCGCTGG - Exonic
1161126713 19:2561950-2561972 CCCGGGGCAGCTGCCTCTGCTGG - Intronic
1162376783 19:10309718-10309740 CCCTCCGCAGCTGCCGGGGCGGG + Exonic
1162772362 19:12956957-12956979 GCCGGAGCAGCTGCGGGAGCTGG - Exonic
1162916556 19:13877383-13877405 CCTGGAGCCGATGCCAGCGCCGG + Exonic
1162987144 19:14277928-14277950 CGCGGAGCAGGGGGCGGCGCTGG - Intergenic
1163633865 19:18429620-18429642 CCTGGAGCAGCTGCCCTCCCAGG - Intronic
1163702042 19:18790906-18790928 CCCGAAGCATCTGCGGGCCCAGG + Exonic
1165475262 19:36026700-36026722 CTCGCAGCAGCTGCTGGCGCTGG - Exonic
1165477405 19:36039391-36039413 CCAGGCGCAGCTGCAGGCCCTGG - Exonic
1167018944 19:46860532-46860554 GCCGGCGCAGCTGCTGGCGCAGG - Intergenic
1167050023 19:47072434-47072456 CCCGCAGCAGCTGCAGCAGCAGG - Exonic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1167251018 19:48398476-48398498 CCCGGAGGAGGCGCCGGGGCCGG + Exonic
1167271375 19:48508445-48508467 CCCTGAGCAGGTGCCCGAGCAGG - Intronic
1167503071 19:49858099-49858121 CCCGCAGCAGCTGCTGGTGAGGG + Exonic
1167765939 19:51482540-51482562 CCCTGAGCAGCTGCAGCCTCTGG - Intronic
1168256137 19:55166378-55166400 GCCGAAGCCGCTGCCGGAGCCGG + Exonic
925140948 2:1549535-1549557 CCCGGAGCAGCTGCAGCCAGTGG + Intergenic
926190007 2:10721489-10721511 CGGGGAGCAGGTGCAGGCGCCGG - Intergenic
927488215 2:23503737-23503759 CCGGCAGCAGCTGCCAGCGAAGG + Intronic
927542598 2:23926606-23926628 GGCGGGGCAGCTGGCGGCGCGGG + Exonic
927887666 2:26728582-26728604 CCTGGAGCACCTGGGGGCGCGGG + Exonic
928094191 2:28393835-28393857 CCCGGTGCACCTGGCGGCGCGGG + Intronic
928181463 2:29071508-29071530 GCAGGAGCAGCTGCCAGCCCAGG - Exonic
928437665 2:31266173-31266195 CCAGGACCAGCTGCAGGCCCAGG + Exonic
930798517 2:55419291-55419313 CCACGAGCAGCAGCCTGCGCTGG + Exonic
931036646 2:58251542-58251564 ACCGGAGCCGCAGCCGGTGCTGG - Intergenic
931253391 2:60551852-60551874 CCCGGAGCAGGCGGCGGCGGCGG - Intronic
931429213 2:62196086-62196108 CCAGGCGCAGCAGCCGCCGCGGG - Intergenic
931516969 2:63055696-63055718 CCCGCAGCCGCTGCAGCCGCTGG - Exonic
932105129 2:68935378-68935400 CCTGGAGGAGCTGCAGGCCCTGG - Intergenic
932564683 2:72898437-72898459 CCCGGAGCAGCTGTGGGCTGAGG - Intergenic
932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG + Exonic
934488307 2:94738178-94738200 CCCTGGGCAGTTGCCGGCGGAGG - Intergenic
935165799 2:100567684-100567706 CCCTGAGGAGCTGGAGGCGCTGG + Intronic
937263069 2:120598653-120598675 CACGGTGCAGCTGCCGTGGCAGG + Intergenic
937751380 2:125479197-125479219 CCCAGAGCAGGGGGCGGCGCCGG + Intergenic
937954865 2:127416433-127416455 CCTGGAGCGGCTGCCTGTGCTGG + Intergenic
938398033 2:130964750-130964772 CCAGGACCAGCTGCCTCCGCTGG - Intronic
940316830 2:152335569-152335591 CCCGGAGCAGCCCCCGGCCCCGG + Exonic
941986675 2:171517566-171517588 CCCGGTTCAGCCGCCGCCGCTGG + Intergenic
942491137 2:176490635-176490657 CCTGGAGCAGCTTCCGCCGATGG + Intergenic
944933678 2:204545676-204545698 CGCGGAGCAGCCGCCTGGGCCGG + Intergenic
945988170 2:216371464-216371486 GCAGCAGCAGCTGCGGGCGCGGG - Exonic
946246020 2:218387874-218387896 CCCCGAGCTGCTGCAGGCGGTGG + Exonic
946404106 2:219483670-219483692 CCCGCAGCAGCCGCTGGCGCAGG - Exonic
947732059 2:232436758-232436780 CGCGGGGCAGCTGCAGGGGCAGG + Intergenic
948199623 2:236120270-236120292 CCCGCAGCAGGTGCTGGCCCAGG - Exonic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
948897840 2:240935441-240935463 GGCGGAGCAGCAGCTGGCGCTGG + Intronic
948903300 2:240966694-240966716 CCCTGAAGAGCTGCCGGGGCTGG + Intronic
1168757284 20:326149-326171 CCTGCAGCAGCTGCCAGCGGCGG - Exonic
1170150508 20:13221729-13221751 CCCGGCGCGGCGGCCGGCGGCGG - Intergenic
1171034559 20:21705185-21705207 CCCGGGGCAGCGGCCGGGGAAGG - Intergenic
1171500711 20:25590973-25590995 CCAGAAGCAGCTGCCAGCTCTGG - Intergenic
1172517424 20:35544653-35544675 CCAGGCACAGCTGCCGCCGCGGG - Intronic
1172618737 20:36306503-36306525 CCCGGCGCAGGTGAGGGCGCGGG + Exonic
1172784278 20:37456238-37456260 CCTGGAGCAACTGCTGGTGCTGG + Intergenic
1172841114 20:37903230-37903252 CGAGGGGCAGCTGCCGGAGCCGG + Exonic
1175149860 20:56925245-56925267 GCCGGAGCGGCGGCGGGCGCGGG + Intergenic
1175349545 20:58308942-58308964 CCCACGGCAGCTGCAGGCGCAGG + Intergenic
1175368362 20:58470698-58470720 CCGGGGGCAGCTGCCTGCGCTGG - Exonic
1175847201 20:62065286-62065308 CCCGGGGCCGGGGCCGGCGCGGG + Exonic
1175872792 20:62216408-62216430 CCTCGAGGAGCTGCCGGAGCTGG + Exonic
1176173589 20:63707537-63707559 CCAGGAGCCCCTGCAGGCGCCGG + Intronic
1179882686 21:44300120-44300142 CCTGGAGAAGCTGCGGGCGTCGG + Exonic
1179901759 21:44397827-44397849 CTCGGAGGAGATGCTGGCGCTGG + Exonic
1179976906 21:44873489-44873511 CCCGGAGCTGGTGAGGGCGCCGG - Exonic
1180071631 21:45439689-45439711 CCCGGAGCTGCTGCCAGCCTGGG + Intronic
1180156626 21:45981507-45981529 CTCGGAGCTGCTGCCGGTTCTGG + Intergenic
1180719499 22:17896867-17896889 CCAGCAGCAGCTGCCGTCTCTGG - Exonic
1180785786 22:18546946-18546968 CTCTGAGCAGCTGACGGCCCAGG - Intergenic
1180824542 22:18853566-18853588 CCCGGAGCAGGTGGAGGCACAGG - Intronic
1181124964 22:20696721-20696743 CCCGGAGCAGGTGGAGGCACAGG - Intergenic
1181131067 22:20732671-20732693 CTCTGAGCAGCTGACGGCCCAGG - Intronic
1181188193 22:21120982-21121004 CCCGGAGCAGGTGGAGGCACAGG + Intergenic
1181211005 22:21289511-21289533 CCCGGAGCAGGTGGAGGCACAGG - Intergenic
1181242711 22:21486500-21486522 CTCTGAGCAGCTGACGGCCCAGG - Intergenic
1181398495 22:22637377-22637399 CCCGGAGCAGGTGGAGGCACAGG + Intergenic
1181501233 22:23316735-23316757 CCCGGAGCAGGTGGAGGCACAGG + Exonic
1181650919 22:24258683-24258705 CCCGGAGCAGGTGGAGGCACAGG - Intergenic
1181706461 22:24652056-24652078 CCCGGAGCAGGTGGAGGCACAGG + Intergenic
1182146764 22:28001502-28001524 CCAGGATGAGCTGCCGGTGCCGG + Exonic
1182278670 22:29205945-29205967 TCCGGGGCGGCTGGCGGCGCGGG + Exonic
1182295987 22:29311488-29311510 CCCGGAGTAGCGGCGGGAGCGGG - Intronic
1182619514 22:31611231-31611253 CCAGCAGCAGCTGCCGGTGGTGG - Exonic
1182664081 22:31944742-31944764 CCGGGAGCAGCTGCTGCAGCGGG + Exonic
1182903780 22:33920231-33920253 CCTGGAGCTGCTCCCGGCCCGGG + Exonic
1183026177 22:35067256-35067278 CCCGGAGAAGCTGCGGCCTCAGG + Exonic
1183235570 22:36614407-36614429 CCAGAAGGAGCTGCCGGCTCAGG - Intronic
1183956175 22:41381952-41381974 CCCGCTGCAGCTGCCGACACGGG - Exonic
1184095517 22:42314322-42314344 CACGGACCAGCTGCCGCTGCCGG + Intronic
1184153122 22:42649696-42649718 CGCTGAGCAGCTGCAGGCACAGG - Intergenic
1184472189 22:44702279-44702301 CCCGGCGGGGCGGCCGGCGCGGG + Intronic
1184711181 22:46250326-46250348 CCCGGTGCAGCCGCAGACGCAGG + Exonic
1184790111 22:46694991-46695013 ACAGCAGCAGCTGCCTGCGCAGG + Intronic
1185027539 22:48424403-48424425 CCCGGAGCTGCTGCCCATGCCGG + Intergenic
1185041097 22:48504832-48504854 CCAGCAGCAGCTGCCAGGGCAGG + Intronic
1185161695 22:49233863-49233885 CCTGGAGCAGCTGCCGCTCCTGG - Intergenic
1185315578 22:50177849-50177871 CCGGCAGCTGCTGGCGGCGCTGG + Exonic
1185318683 22:50190370-50190392 CTCGGTGCAGCAGCAGGCGCTGG - Intronic
1185340244 22:50287784-50287806 CCGGGTGCATCTGCAGGCGCAGG + Exonic
1185345064 22:50307424-50307446 CGCGGAGCCGCAGCCGCCGCAGG + Intronic
1185370797 22:50460011-50460033 CCCTGAGCAGCAGCCTGAGCCGG - Exonic
1203215941 22_KI270731v1_random:5919-5941 CCCGGAGCAGGTGGAGGCACAGG + Intergenic
1203274682 22_KI270734v1_random:79471-79493 CCCGGAGCAGGTGGAGGCACAGG - Intergenic
950653983 3:14425354-14425376 CCCGCAGGAGCTGCCTGCACTGG + Intronic
950940143 3:16884266-16884288 CCCGGGGCAGCTCCCGGAGGGGG - Intronic
952335770 3:32401834-32401856 CCCCGGGCTGCTGCCGGCGCTGG - Intronic
952646439 3:35664667-35664689 TCCGGAGCAGGTGGCGGCGGGGG + Intronic
953909284 3:46883514-46883536 CTCGGGGCAGCCGCCGCCGCCGG - Exonic
953947606 3:47163453-47163475 GTCGGAGGAGCTGCCGGTGCCGG - Intronic
954293233 3:49660662-49660684 CCCGGTCCAGCTCCCGGAGCAGG - Exonic
955953857 3:64268096-64268118 CACAGAGCAGCTGCCGCCCCAGG - Intronic
960664129 3:120094077-120094099 CCAGGAGCAGCTGCAGGCGGCGG + Intronic
961167320 3:124772415-124772437 CCAGCAGCCGCTGCAGGCGCAGG + Intronic
961368635 3:126416393-126416415 CCAGCTGCAGCTGCCGCCGCAGG - Exonic
961682410 3:128608068-128608090 CCTGGAGCACCTGCAGGCCCTGG - Intergenic
962232098 3:133674675-133674697 CCCGGAGCACCTTGCAGCGCCGG - Intergenic
966108164 3:176362263-176362285 CGCGGAGCAGGGGGCGGCGCTGG + Intergenic
966861570 3:184233572-184233594 CCCGAAGCAGCTGGTGGGGCTGG - Exonic
968313683 3:197704572-197704594 CCCCGAGCAGGGGCCGGAGCTGG + Exonic
968323457 3:197791578-197791600 GCCGGGGCGGCTCCCGGCGCCGG - Intronic
968514103 4:1009317-1009339 CCCGGGGCAGGTGCTGTCGCGGG + Intergenic
968595227 4:1478915-1478937 CCAGGAGCATCTGCAGGAGCGGG + Intergenic
969114518 4:4862771-4862793 CACCGCGCAGCTGCTGGCGCTGG + Exonic
969288308 4:6222086-6222108 CCGGGCGCAGCGGCGGGCGCCGG + Intergenic
969402233 4:6963113-6963135 CCCGGACCAGCTGCCGGGCCTGG - Intronic
969559826 4:7939821-7939843 CGCGGAGCTGCAGCCGGCGTGGG + Exonic
971257896 4:25030752-25030774 CCCGGCGCCGCTGCAGACGCGGG + Exonic
971281681 4:25246835-25246857 CCCTCTGCAGCTGCTGGCGCGGG + Intronic
971635107 4:29047659-29047681 CCCTCAGCAGCTGCTGGCCCGGG - Intergenic
973907375 4:55546069-55546091 CCCGGAGGAGCTGGCCGCCCCGG + Intronic
975870852 4:78776626-78776648 GCCGGAGCCGCAGCCGGCCCCGG - Exonic
978617476 4:110611566-110611588 CCCGGAGCAGCGGCGCGTGCGGG + Intergenic
981615024 4:146637341-146637363 CCGGGAGCAGGTGCAGGCACTGG - Intergenic
982281017 4:153684022-153684044 CACGGGGCAGCTGTCGGGGCAGG + Intergenic
982985762 4:162203727-162203749 CCCTCAGCAGCTGCTGGCCCGGG - Intergenic
983752846 4:171298414-171298436 CCCTCCGCAGCTGCCGGCCCGGG - Intergenic
984704736 4:182839499-182839521 CCCGGAGCACCTGTCAGCACAGG - Intergenic
985549088 5:524271-524293 CCGGGGGCTGCTGCTGGCGCTGG - Exonic
985788141 5:1910684-1910706 GCAGGACCAGCTGCCGGGGCGGG - Intergenic
986330715 5:6714238-6714260 CCCCGCGCTGCTGACGGCGCTGG + Intergenic
986710671 5:10486074-10486096 CCCAGAGCAGGGGCCGGCCCAGG - Intergenic
989750239 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG + Intergenic
992195664 5:74336550-74336572 CCAGAAGCAGCTGCCTGCGGAGG - Intergenic
997505276 5:134411982-134412004 CCCGGAGCGGCGGCCTGCGGGGG + Intergenic
999300013 5:150485530-150485552 CTCGGAGCCGCCGCGGGCGCGGG + Intergenic
999309851 5:150544978-150545000 CCTGGAGCAGCTGAGGGGGCGGG + Intronic
1000902449 5:166927028-166927050 CGCGCAGGAGCTGACGGCGCAGG + Intergenic
1002136316 5:177110046-177110068 CCCGGAGCCGGAGCCGGAGCCGG - Intergenic
1002471410 5:179438271-179438293 CCCAGAGTAGCTGACGGCTCTGG - Intergenic
1002521799 5:179796434-179796456 CCCGGGGCAGCTGGAGGCTCCGG - Exonic
1002661178 5:180792068-180792090 GCCGGAGCAGCGGCAGGGGCGGG - Exonic
1003624195 6:7727462-7727484 CCGGGGGCGGCTGCCGACGCTGG - Exonic
1004140564 6:13013849-13013871 GCCGGAGCAGCGCCCGGCCCCGG + Intronic
1005596224 6:27381329-27381351 CTCGGAGCACCTGCCGGCCCCGG - Intronic
1005940470 6:30556265-30556287 CCCGGGGCAGCCCCCGCCGCAGG + Exonic
1006026511 6:31150508-31150530 CGCGGAGCTGCTGCAGGTGCGGG - Exonic
1006294430 6:33163755-33163777 GCTGGAGCAGCTGCCAGTGCTGG - Exonic
1006535556 6:34696404-34696426 CCCGAGGCCGCTGCCAGCGCTGG + Intronic
1006800321 6:36755754-36755776 CCCGTAGCAGCTGCCAGCTCTGG + Intronic
1007363731 6:41375679-41375701 CCCGGAGCGGGAGCCGGGGCGGG + Intergenic
1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG + Exonic
1011416211 6:87122616-87122638 CCTGGAGATGCTGCTGGCGCTGG - Intergenic
1013349193 6:109290547-109290569 CTCGGAGCGGCGGCCGTCGCTGG - Intergenic
1014778999 6:125541862-125541884 CCTGGAGCAGATGCTGGCTCAGG + Intergenic
1016328160 6:142926773-142926795 CCCGGACCAGCTCCCGGCGCTGG + Intronic
1017737901 6:157380866-157380888 CGCGCAGCAGCTGCCGCCTCGGG - Intergenic
1018612620 6:165660610-165660632 CCCGGAGCAGCTTCGGCCGCAGG + Intronic
1018727759 6:166627034-166627056 CCCGGAGCAGCCGCAGGGCCGGG + Intronic
1018727937 6:166627650-166627672 CCCGGGACAGCTCCCGGCCCGGG + Intronic
1018790196 6:167142379-167142401 CCAGGAGCAGGTGCAGGCGCTGG - Intergenic
1019310246 7:356975-356997 CCCGCAGCAGCAGCCTGCTCCGG - Intergenic
1019446297 7:1073374-1073396 GCCGGAGGAGCTGCCTGCGCGGG - Intronic
1019617977 7:1975157-1975179 CCCCGAGCAGCTTCAGGAGCAGG - Intronic
1019693741 7:2432900-2432922 GACGGAGCAGCCGCCTGCGCCGG + Exonic
1019716486 7:2541717-2541739 CCTGGAGGAGCTGCAGCCGCTGG - Exonic
1019983982 7:4641941-4641963 CACGGCGCGGCTGCCGGCGAGGG + Intergenic
1020016485 7:4834801-4834823 CCAGGAGCAGCTGCTGGCGCCGG + Exonic
1020070795 7:5225770-5225792 CCTGGGGCAGCTGCTGGCTCCGG + Intronic
1020375349 7:7478765-7478787 CCCTCCGCAGCTGCTGGCGCGGG + Intronic
1020784386 7:12556199-12556221 CGCGGAGCAGGGGGCGGCGCTGG + Intergenic
1021945820 7:25726270-25726292 CCCAGAGCAGCTGCTCACGCTGG - Intergenic
1022559745 7:31336243-31336265 TGCCGAGCAGCTGCTGGCGCGGG - Intergenic
1023885279 7:44349639-44349661 CCAGGAGCAGCTGAGGGGGCAGG - Intergenic
1024043880 7:45574617-45574639 CCGGGACAAGCCGCCGGCGCGGG + Exonic
1028871144 7:95772718-95772740 CCAGGAGCCGCCGCCGGCTCGGG + Exonic
1029552398 7:101244404-101244426 CCCGGAGCAGCTGACCCCGGCGG + Intronic
1029652596 7:101903661-101903683 GGCGGAGCAGGTGCCGGGGCAGG - Intronic
1030075695 7:105734388-105734410 CCCGGGGCAGCTGCTGCAGCTGG + Intronic
1032013564 7:128361647-128361669 CCCGGCGAAGCCGCCCGCGCCGG + Exonic
1033609794 7:142954222-142954244 CCTGGAGCAGCGGCGGGCACAGG - Exonic
1034270651 7:149802110-149802132 GCCGCAGCAGCTCCTGGCGCTGG - Intergenic
1035053389 7:156017633-156017655 TCCTCTGCAGCTGCCGGCGCTGG - Intergenic
1035629144 8:1095090-1095112 CCTGGGGCAGCAGCCTGCGCTGG + Intergenic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1039474018 8:37829887-37829909 CCCAGGGCAGCAGCCAGCGCAGG - Exonic
1039568319 8:38566370-38566392 CCCTGAGCAGCTGCAGGCTGTGG + Intergenic
1040038898 8:42896975-42896997 TGCGGAGCCGCTGCCAGCGCTGG + Exonic
1041200955 8:55451749-55451771 CCCTGAGCAGCCGCCTGAGCCGG - Intronic
1041719562 8:60964027-60964049 CCAGGAGCCGCTGCCGGAGTGGG + Intergenic
1042611790 8:70608213-70608235 GGCGGAGCACCTGCAGGCGCGGG - Exonic
1047998529 8:130358425-130358447 CGCTGAGGAGCTGCCGCCGCCGG - Intronic
1048207635 8:132427979-132428001 CCGGGAGCATCTGCAGGCGAAGG - Intronic
1049412158 8:142478232-142478254 CTGGGAGCAGCTGGCGGAGCAGG - Exonic
1049419480 8:142510579-142510601 CCCGGAGGAGCTGGGGGCGGCGG + Intronic
1049548515 8:143246034-143246056 CCCGGAGGGGCTGCCTGCGGCGG + Intergenic
1049621211 8:143599067-143599089 CCCGGAGGAGCTGCAGACACCGG + Exonic
1049646450 8:143737984-143738006 CCCGGAGCAGTGGCCGGCACCGG + Intergenic
1049759743 8:144326607-144326629 ACCGCGGCAGCTCCCGGCGCCGG - Exonic
1053414725 9:37939940-37939962 CCCAGAGCAGGTGGCGGGGCAGG + Intronic
1053669481 9:40346186-40346208 CCCTGGGCAGTTGCCGGCGGAGG + Intergenic
1054380613 9:64486206-64486228 CCCTGGGCAGTTGCCGGCGGAGG + Intergenic
1054515133 9:66030105-66030127 CCCTGGGCAGTTGCCGGCGGAGG - Intergenic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1058618926 9:106863321-106863343 CCCGAAGCACCTCCCGGCGCCGG + Exonic
1059653341 9:116335026-116335048 CCCTGAGCAGCTGCCAGAGAGGG + Exonic
1061283674 9:129610724-129610746 CGCGGTGCTGCAGCCGGCGCAGG + Intronic
1061817955 9:133207572-133207594 GCAGGAGCAGCTGCTGGAGCTGG - Intronic
1062151536 9:135021689-135021711 CATGGAGCAGCTGCTGGTGCTGG + Intergenic
1062242444 9:135547602-135547624 GCAGGAGCAGCTGCTGGAGCTGG + Intronic
1062547414 9:137069968-137069990 CCCGGAGCAGCTGTGCGCCCCGG - Exonic
1062595247 9:137296294-137296316 CCCGGAGCCGCTCCCCCCGCTGG - Intergenic
1186350066 X:8731708-8731730 CCAGGATCAGCCGGCGGCGCTGG + Intronic
1189321814 X:40091746-40091768 CCAGGAGAAGCCGCCGGGGCGGG - Intronic
1189418175 X:40832888-40832910 CCGGGAGCAGCTGCAGCGGCAGG - Intergenic
1190233354 X:48598771-48598793 CCCGCAGCAGCTGGCTGCGCCGG - Exonic
1199500389 X:148500732-148500754 CCCGCCGCCGCTGCCGCCGCCGG + Exonic